RegulonDB RegulonDB 10.8: Gene Sequence
hyaC gene sequence


Size: 708        A: 146  T: 195  G: 202  C: 165

Fasta

 

>hyaC E. coli K12. Version NC_000913.3 GI:556503834
atgcaacagaaaagcgacaacgttgtcagccactatgtctttgaagcgccagtgcgcatc
tggcactggttgacggtgttatgcatggcggtgttgatggtcaccggatactttatcggc
aagccgctaccttccgtcagcggcgaggcgacgtatctgttctatatgggctacatcagg
ttaattcacttcagcgccgggatggtttttaccgtggttttgctgatgcggatctactgg
gcttttgttggcaatcgatactcccgcgagctgtttatcgtgccggtatggcgtaaaagc
tggtggcagggcgtgtggtatgaaatccgctggtatctgtttctggcaaaacgtccgagt
gccgatataggccataatcccatcgcccaggcggcgatgttcggctatttcctgatgtcg
gtctttatgatcatcactggttttgcgctgtacagcgaacacagccagtacgctattttt
gcgccgttccgttatgtggtggaatttttctactggacgggtggcaactcaatggacatt
cacagctggcatcggctggggatgtggctgattggcgcgtttgtgatcggtcatgtctac
atggcgctgcgtgaagacatcatgtccgacgacacggtgatctccaccatggtcaacggc
taccgtagccacaaatttggcaaaataagtaacaaggagcgttcatga
              
                            

Download fasta file
RegulonDB