RegulonDB RegulonDB 10.8: Gene Sequence
hyaE gene sequence


Size: 399        A: 85  T: 88  G: 122  C: 104

Fasta

 

>hyaE E. coli K12. Version NC_000913.3 GI:556503834
atgagcaacgacacgccatttgatgcgttgtggcaacgaatgctggcgcgcggctggacg
ccagtcagtgaatcccgtcttgacgactggcttacgcaagcgccagacggcgtggtgtta
ttaagcagtgacccgaaacgcacgccagaggtcagcgataatccggtaatgattggcgaa
ttactgcgcgagtttcccgactatacatggcaggtggcgattgctgaccttgagcagagc
gaagccatcggcgatcgctttggcgtctttcgctttcctgccactttagtgtttaccggc
ggaaactatcgcggcgtgctgaatggtattcacccgtgggcggaactgataaacctgatg
cgcgggcttgtcgaaccgcagcaggagcgtgcctcatga
              
                            

Download fasta file
RegulonDB