RegulonDB RegulonDB 10.9: Gene Sequence
hyaF gene sequence


Size: 858        A: 202  T: 185  G: 251  C: 220

Fasta

 

>hyaF E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaaacttttttccatctgctggggccaggaacgcaaccgaacgatgacagtttc
agcatgaatccactgccgatcacctgtcaggtgaatgatgaaccgagtatggcggccctg
gagcaatgtgctcacagcccgcaggtgattgcgctgttaaacgagttacaacatcaacta
agcgaacgccaaccgccgttgggcgaggtgctggcagtcgatctgttaaatctcaacgcc
gacgatcgtcactttatcaatacgcttctcggggaaggggaagtgtcagtgcgcattcag
caggctgacgacagtgaaagtgaaatacaggaggcgatcttctgcggattatggcgggtg
cgcagacgtcgcggcgaaaagttgctggaggacaaactggaggctggctgcgcgccgctg
gcgttgtggcaggcggcaacgcaaaatctcttgccgacagattcgctgttaccgccgccc
attgatggcctgatgaatggcctaccgttggcgcatgagttactggcacatgtacgtaac
cccgacgcgcagccgcacagcattaatctgacgcaattacccatcagcgaggctgatcgg
ctttttctctcacgtctctgtgggccgggaaatattcagattcgtaccattggctatggc
gagagctatatcaacgccacggggttacgccatgtctggcatttacgctgtacggacacc
ttaaaaggcccgttactggaaagttatgaaatctgcccaataccggaagtggtgctggca
gcgccagaagatttggtcgactctgcgcagcggcttagcgaggtatgtcagtggctggcg
gaagctgcaccgacgtaa
              
                            

Download fasta file
RegulonDB