RegulonDB RegulonDB 10.9: Gene Sequence
hycG gene sequence


Size: 768        A: 158  T: 177  G: 227  C: 206

Fasta

 

>hycG E. coli K12. Version NC_000913.3 GI:556503834
atgagcaatttattaggcccccgtgacgccaacggcattccggtccccatgacggtggat
gaatccatcgccagcatgaaggcgtcgttactgaaaaaaatcaaacgttctgcctatgtt
taccgcgtggactgcggcggctgcaacggttgcgaaatcgaaattttcgccacgctttcg
ccgctgtttgatgcagaacgcttcggcattaaagtcgttccttcaccgcgtcatgcggat
attttactgtttaccggcgcggtcacccgtgcaatgcgatcccctgcgctgcgtgcgtgg
cagtccgcgccggacccgaaaatttgtatctcctacggtgcctgcggtaacagtggcggg
atcttccacgatctctactgcgtgtggggcggtacggataaaattgtccctgtggatgtt
tatatccctggctgcccgccaacgcctgccgccacgctgtacggctttgcaatggcgctc
ggcctgctggagcagaaaattcacgcccgtgggccgggtgaactggatgaacaaccggcg
gagatcctgcatggtgatatggtgcagccgctgcgcgtgaaagtggatcgcgaagcacgt
cgcctggcgggttatcgttacggtcgtcagattgccgatgattaccttacacagttaggg
cagggcgaagaacaggttgcacgctggctggaagcggaaaacgatccgcgtctgaacgag
attgtcagccatctgaatcatgttgttgaagaggcgcgtatccgatga
              
                            

Download fasta file
RegulonDB