RegulonDB RegulonDB 10.10: Gene Sequence
iap gene sequence


Size: 1038        A: 282  T: 244  G: 276  C: 236

Fasta

 

>iap E. coli K12. Version NC_000913.3 GI:556503834
atgttttccgcattgcgccaccgtaccgctgccctggcgctcggcgtatgctttattctc
cccgtacacgcctcgtcacctaaacctggcgattttgctaatactcaggcacgacatatt
gctactttctttccgggacgcatgaccggaactcctgcagaaatgttatctgccgattat
attcgccaacagtttcagcaaatgggttatcgcagtgatattcggacatttaatagtcgg
tatatttataccgcccgcgataatcgtaagagctggcataacgtgacgggaagtacggtg
attgccgctcatgaaggcaaagcgccgcagcagatcatcattatggcgcatctggatact
tacgccccgctgagcgatgctgacgccgatgccaatctcggcgggctgacgttacaagga
atggatgataacgccgcaggtttaggtgtcatgctggaattggcagaacgcctgaaaaat
acgcctaccgagtatggtattcgatttgtggcgaccagcggcgaagaggaagggaaatta
ggcgctgagaatttactcaagcggatgagtgacaccgaaaagaaaaatacgctgctggtg
attaatctcgataacttaattgttggcgataaattgtatttcaacagcggtgtaaaaacc
cctgaggcagtaaggaaattaacgcgcgacagggcgctggcaattgcgcgcagtcacgga
atagccgcaacgaccaatccgggtttgaataaaaattatccgaaaggcactgggtgttgt
aatgacgcagaaatattcgacaaagcgggcattgctgtactttcggtggaagcgactaac
tggaatcttgggaataaggatggttatcagcaacgcgcaaaaacacctgccttcccggcg
ggaaatagctggcatgacgtaagactggataatcaccaacatattgataaggctcttcct
ggaagaatagaacgtcgctgccgtgacgttatgcggataatgctacctctggtgaaggag
ttggcgaaggcgtcttga
              
                            

Download fasta file
RegulonDB