RegulonDB RegulonDB 10.9: Gene Sequence
icd gene sequence


Size: 1251        A: 332  T: 291  G: 336  C: 292

Fasta

 

>icd E. coli K12. Version NC_000913.3 GI:556503834
atggaaagtaaagtagttgttccggcacaaggcaagaagatcaccctgcaaaacggcaaa
ctcaacgttcctgaaaatccgattatcccttacattgaaggtgatggaatcggtgtagat
gtaaccccagccatgctgaaagtggtcgacgctgcagtcgagaaagcctataaaggcgag
cgtaaaatctcctggatggaaatttacaccggtgaaaaatccacacaggtttatggtcag
gacgtctggctgcctgctgaaactcttgatctgattcgtgaatatcgcgttgccattaaa
ggtccgctgaccactccggttggtggcggtattcgctctctgaacgttgccctgcgccag
gaactggatctctacatctgcctgcgtccggtacgttactatcagggcactccaagcccg
gttaaacaccctgaactgaccgatatggttatcttccgtgaaaactcggaagacatttat
gcgggtatcgaatggaaagcagactctgccgacgccgagaaagtgattaaattcctgcgt
gaagagatgggggtgaagaaaattcgcttcccggaacattgtggtatcggtattaagccg
tgttcggaagaaggcaccaaacgtctggttcgtgcagcgatcgaatacgcaattgctaac
gatcgtgactctgtgactctggtgcacaaaggcaacatcatgaagttcaccgaaggagcg
tttaaagactggggctaccagctggcgcgtgaagagtttggcggtgaactgatcgacggt
ggcccgtggctgaaagttaaaaacccgaacactggcaaagagatcgtcattaaagacgtg
attgctgatgcattcctgcaacagatcctgctgcgtccggctgaatatgatgttatcgcc
tgtatgaacctgaacggtgactacatttctgacgccctggcagcgcaggttggcggtatc
ggtatcgcccctggtgcaaacatcggtgacgaatgcgccctgtttgaagccacccacggt
actgcgccgaaatatgccggtcaggacaaagtaaatcctggctctattattctctccgct
gagatgatgctgcgccacatgggttggaccgaagcggctgacttaattgttaaaggtatg
gaaggcgcaatcaacgcgaaaaccgtaacctatgacttcgagcgtctgatggatggcgct
aaactgctgaaatgttcagagtttggtgacgcgatcatcgaaaacatgtaa
              
                            

Download fasta file
RegulonDB