RegulonDB RegulonDB 10.9: Gene Sequence
argP gene sequence


Size: 894        A: 205  T: 203  G: 241  C: 245

Fasta

 

>argP E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgcccggactacagaacattacaggcactggatgcggtgatacgtgaacgagga
tttgagcgcgcggcacaaaagctgtgcattacacaatcagccgtctcacagcgcattaag
caactggaaaatatgttcgggcagccgctgttggtgcgtaccgtaccgccgcgcccgacg
gaacaagggcaaaaactgctggcactgctgcgccaggtggagttgctggaagaagagtgg
ctgggcgatgaacaaaccggttcgactccgctgctgctttcactggcggtcaacgccgac
agtctggcgacgtggttgcttcctgcactggctcctgtgttggctgattcgcctatccgc
ctcaacttgcaggtagaagatgaaacccgcactcaggaacgtctgcgccgcggcgaagtg
gtcggcgcggtgagtattcaacatcaggcgctgccgagttgtcttgtcgataaacttggt
gcgctcgactatctgttcgtcagctcaaaaccctttgccgaaaaatatttccctaacggc
gtaacgcgttcggcattactgaaagcgccagtggtcgcgtttgaccatcttgacgatatg
caccaggcctttttgcagcaaaacttcgatctgcctccaggcagcgtgccctgccatatc
gttaattcttcagaagcgttcgtacaacttgctcgccagggcaccacctgctgtatgatc
ccgcacctgcaaatcgagaaagagctggccagcggtgaactgattgacttaacgcctggg
ctatttcaacgacggatgctctactggcaccgctttgctcctgaaagccgcatgatgcgt
aaagtcactgatgcgttactcgattatggtcacaaagtccttcgtcaggattaa
              
                            

Download fasta file
RegulonDB