RegulonDB RegulonDB 10.10: Gene Sequence
iclR gene sequence


Size: 825        A: 195  T: 183  G: 230  C: 217

Fasta

 

>iclR E. coli K12. Version NC_000913.3 GI:556503834
atggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgccaccgcaccagcg
actggacaggttcagtctttaacgcgtggcctgaaattactggagtggattgccgaatcc
aatggcagtgtggcactcacggaactggcgcaacaagccgggttacccaattccacgacc
caccgcctgctaaccacgatgcaacagcagggtttcgtgcgtcaggttggcgaactggga
cattgggcaatcggcgcacatgcctttatggtcggcagcagctttctccagagccgtaat
ttgttagcgattgttcaccctatcctgcgcaatctaatggaagagtctggcgaaacggtc
aatatggcggtgcttgatcaaagcgatcacgaagcgattattatcgaccaggtacagtgt
acgcatctgatgcgaatgtccgcgcctatcggcggtaaattgccgatgcacgcttccggt
gcgggtaaagcctttttagcccaactgagcgaagaacaggtgacgaagctgctgcaccgc
aaagggttacatgcctatacccacgcaacgctggtgtctcctgtgcatttaaaagaagat
ctcgcccaaacgcgcaaacggggttattcatttgacgatgaggaacatgcactggggcta
cgttgccttgcagcgtgtattttcgatgagcaccgtgaaccgtttgccgcaatttctatt
tccggaccgatttcacgtattaccgatgaccgcgtgaccgagtttggcgcgatggtgatt
aaagcggcgaaggaagtgacgctggcgtacggtggaatgcgctga
              
                            

Download fasta file
RegulonDB