RegulonDB RegulonDB 10.10: Gene Sequence
ilvI gene sequence


Size: 1725        A: 399  T: 413  G: 507  C: 406

Fasta

 

>ilvI E. coli K12. Version NC_000913.3 GI:556503834
atggagatgttgtctggagccgagatggtcgtccgatcgcttatcgatcagggcgttaaa
caagtattcggttatcccggaggcgcagtccttgatatttatgatgcattgcataccgtg
ggtggtattgatcatgtattagttcgtcatgagcaggcggcggtgcatatggccgatggc
ctggcgcgcgcgaccggggaagtcggcgtcgtgctggtaacgtcgggtccaggggcgacc
aatgcgattactggcatcgccaccgcttatatggattccattccattagttgtcctttcc
gggcaggtagcgacctcgttgataggttacgatgcctttcaggagtgcgacatggtgggg
atttcgcgaccggtggttaaacacagttttctggttaagcaaacggaagacattccgcag
gtgctgaaaaaggctttctggctggcggcaagtggtcgcccaggaccagtagtcgttgat
ttaccgaaagatattcttaatccggcgaacaaattaccctatgtctggccggagtcggtc
agtatgcgttcttacaatcccactactaccggacataaagggcaaattaagcgtgctctg
caaacgctggtagcggcaaaaaaaccggttgtctacgtaggcggtggggcaatcacggcg
ggctgccatcagcagttgaaagaaacggtggaggcgttgaatctgcccgttgtttgctca
ttgatggggctgggggcgtttccggcaacgcatcgtcaggcactgggcatgctgggaatg
cacggtacctacgaagccaatatgacgatgcataacgcggatgtgattttcgccgtcggg
gtacgatttgatgaccgaacgacgaacaatctggcaaagtactgcccaaatgccactgtt
ctgcatatcgatattgatcctacttccatttctaaaaccgtgactgcggatatcccgatt
gtgggggatgctcgccaggtcctcgaacaaatgcttgaactcttgtcgcaagaatccgcc
catcaaccactggatgagatccgcgactggtggcagcaaattgaacagtggcgcgctcgt
cagtgcctgaaatatgacactcacagtgaaaagattaaaccgcaggcggtgatcgagact
ctttggcggttgacgaagggagacgcttacgtgacgtccgatgtcgggcagcaccagatg
tttgctgcactttattatccattcgacaaaccgcgtcgctggatcaattccggtggcctc
ggcacgatgggttttggtttacctgcggcactgggcgtcaaaatggcgttgccagaagaa
accgtggtttgcgtcactggcgacggcagtattcagatgaacatccaggaactgtctacc
gcgttgcaatacgagttgcccgtactggtggtgaatctcaataaccgctatctggggatg
gtgaagcagtggcaggacatgatctattccggccgtcattcacaatcttatatgcaatcg
ctacccgatttcgtccgtctggcggaagcctatgggcatgtcgggatccagatttctcat
ccgcatgagctggaaagcaaacttagcgaggcgctggaacaggtgcgcaataatcgcctg
gtgtttgttgatgttaccgtcgatggcagcgagcacgtctacccgatgcagattcgcggg
ggcggaatggatgaaatgtggttaagcaaaacggagagaacctga
              
                            

Download fasta file
RegulonDB