RegulonDB RegulonDB 10.10: Gene Sequence
ilvN gene sequence


Size: 291        A: 78  T: 72  G: 70  C: 71

Fasta

 

>ilvN E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaacacaactcatgacaacgtaattctggagctcaccgttcgcaaccatccgggc
gtaatgacccacgtttgtggcctttttgcccgccgcgcttttaacgttgaaggcattctt
tgtctgccgattcaggacagcgacaaaagccatatctggctactggtcaatgacgaccag
cgtctggagcagatgataagccaaatcgataagctggaagatgtcgtgaaagtgcagcgt
aatcagtccgatccgacgatgtttaacaagatcgcggtgttttttcagtaa
              
                            

Download fasta file
RegulonDB