RegulonDB RegulonDB 11.0: Gene Sequence
infA gene sequence


Size: 219        A: 65  T: 48  G: 51  C: 55

Fasta

 

>infA E. coli K12. Version NC_000913.3 GI:556503834
atggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaatacc
atgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatg
cgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtac
gacctgagcaaaggccgcattgtcttccgtagtcgctga
              
                            

Download fasta file
RegulonDB