RegulonDB RegulonDB 10.9: Gene Sequence
infC gene sequence


Size: 543        A: 169  T: 110  G: 147  C: 117

Fasta

 

>infC E. coli K12. Version NC_000913.3 GI:556503834
attaaaggcggaaaacgagttcaaacggcgcgccctaaccgtatcaatggcgaaattcgc
gcccaggaagttcgcttaacaggtctggaaggcgagcagcttggtattgtgagtctgaga
gaagctctggagaaagcagaagaagccggagtagacttagtcgagatcagccctaacgcc
gagccgccggtttgtcgtataatggattacggcaaattcctctatgaaaagagcaagtct
tctaaggaacagaagaaaaagcaaaaagttatccaggttaaggaaattaaattccgtcct
ggtacagatgaaggcgactatcaggtaaaactccgcagcctgattcgctttctcgaagag
ggtgataaagccaaaatcacgctgcgtttccgcggtcgtgagatggcgcaccagcaaatc
ggtatggaagtgcttaatcgcgtgaaagacgatttgcaagaactggcagtggtcgaatcc
ttcccaacgaagatcgaaggccgccagatgatcatggtgctcgctcctaagaagaaacag
taa
              
                            

Download fasta file
RegulonDB