RegulonDB RegulonDB 10.9: Gene Sequence
intD gene sequence


Size: 1164        A: 371  T: 247  G: 305  C: 241

Fasta

 

>intD E. coli K12. Version NC_000913.3 GI:556503834
atgtcactcttccgcagaaatgaaatatggtatgcctcgtattcgctcccgggcgggaaa
cgaattaaggaatctcttggcacaaaggacaaacggcaagctcaggagttgcacgacaag
cgaaaagcagaactctggcgagtagaaaagctaggggatttacctgatgtcacttttgaa
gaggcctgcctaagatggcttgaggaaaaagctgataaaaaatctctcgattcagataaa
agccggattgagttctggcttgaacattttgagggtataaggcttaaagatatctcggag
gcaaagatttactctgctgtaagcagaatgcataacagaaagacgaaagaaatatggaaa
cagaaagttcaggccgccatcaggaaaggtaaagaactgcctgtttatgaaccaaagcca
gtatcaactcagacaaaggcaaagcatcttgccatgataaaggccattctccgtgctgca
gaacgcgactggaagtggctggaaaaagcgcctgtcatcaagataccagcggtcagaaac
aagcgagtcagatggctggaaaaggaggaagcaaaacgccttattgatgagtgccccgaa
ccactgaaatctgtcgtcaagtttgcgctggcaactggtctgagaaagtcgaacatcata
aatctggaatggcaacaaatcgacatgcagcgacgagttgcctgggtgaatccagaagag
agcaaatcaaaccgcgccattggtgtggcgctgaacgataccgcctgtaaagtgttgcgt
gatcaaataggcaagcatcacaaatgggtgtttgtacataccaaggcggctaagcgagca
gatggaacatcaacgcctgcggtcaggaagatgcgcatcgacagcaagacatcatggcta
tcagcttgtcgtcgtgcaggaattgaagatttccgtttccatgacctcagacacacctgg
gcaagctggctgattcagtcaggcgtcccattatcagtgcttcaggaaatgggcggatgg
gagtccatagaaatggttcgtaggtatgctcaccttgcgcctaatcatttgacagagcat
gcgaggaaaatagacgacatttttggtgataatgtcccaaatatgtcccactctgaaatt
atggaggatataaagaaggcgtaa
              
                            

Download fasta file
RegulonDB