RegulonDB RegulonDB 10.9: Gene Sequence
katE gene sequence


Size: 2262        A: 566  T: 518  G: 567  C: 611

Fasta

 

>katE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcaacataacgaaaagaacccacatcagcaccagtcaccactacacgattccagc
gaagcgaaaccggggatggactcactggcacctgaggacggctctcatcgtccagcggct
gaaccaacaccgccaggtgcacaacctaccgccccagggagcctgaaagcccctgatacg
cgtaacgaaaaacttaattctctggaagacgtacgcaaaggcagtgaaaattatgcgctg
accactaatcagggcgtgcgcatcgccgacgatcaaaactcactgcgtgccggtagccgt
ggtccaacgctgctggaagattttattctgcgcgagaaaatcacccactttgaccatgag
cgcattccggaacgtattgttcatgcacgcggatcagccgctcacggttatttccagcca
tataaaagcttaagcgatattaccaaagcggatttcctctcagatccgaacaaaatcacc
ccagtatttgtacgtttctctaccgttcagggtggtgctggctctgctgataccgtgcgt
gatatccgtggctttgccaccaagttctataccgaagagggtatttttgacctcgttggc
aataacacgccaatcttctttatccaggatgcgcataaattccccgattttgttcatgcg
gtaaaaccagaaccgcactgggcaattccacaagggcaaagtgcccacgatactttctgg
gattatgtttctctgcaacctgaaactctgcacaacgtgatgtgggcgatgtcggatcgc
ggcatcccccgcagttaccgcaccatggaaggcttcggtattcacaccttccgcctgatt
aatgccgaagggaaggcaacgtttgtacgtttccactggaaaccactggcaggtaaagcc
tcactcgtttgggatgaagcacaaaaactcaccggacgtgacccggacttccaccgccgc
gagttgtgggaagccattgaagcaggcgattttccggaatacgaactgggcttccagttg
attcctgaagaagatgaattcaagttcgacttcgatcttctcgatccaaccaaacttatc
ccggaagaactggtgcccgttcagcgtgtcggcaaaatggtgctcaatcgcaacccggat
aacttctttgctgaaaacgaacaggcggctttccatcctgggcatatcgtgccgggactg
gacttcaccaacgatccgctgttgcagggacgtttgttctcctataccgatacacaaatc
agtcgtcttggtgggccgaatttccatgagattccgattaaccgtccgacctgcccttac
cataatttccagcgtgacggcatgcatcgcatggggatcgacactaacccggcgaattac
gaaccgaactcgattaacgataactggccgcgcgaaacaccgccggggccgaaacgcggc
ggttttgaatcataccaggagcgcgtggaaggcaataaagttcgcgagcgcagcccatcg
tttggcgaatattattcccatccgcgtctgttctggctaagtcagacgccatttgagcag
cgccatattgtcgatggtttcagttttgagttaagcaaagtcgttcgtccgtatattcgt
gagcgcgttgttgaccagctggcgcatattgatctcactctggcccaggcggtggcgaaa
aatctcggtatcgaactgactgacgaccagctgaatatcaccccacctccggacgtcaac
ggtctgaaaaaggatccatccttaagtttgtacgccattcctgacggtgatgtgaaaggt
cgcgtggtagcgattttacttaatgatgaagtgagatcggcagaccttctggccattctc
aaggcgctgaaggccaaaggcgttcatgccaaactgctctactcccgaatgggtgaagtg
actgcggatgacggtacggtgttgcctatagccgctacctttgccggtgcaccttcgctg
acggtcgatgcggtcattgtcccttgcggcaatatcgcggatatcgctgacaacggcgat
gccaactactacctgatggaagcctacaaacaccttaaaccgattgcgctggcgggtgac
gcgcgcaagtttaaagcaacaatcaagatcgctgaccagggtgaagaagggattgtggaa
gctgacagcgctgacggtagttttatggatgaactgctaacgctgatggcagcacaccgc
gtgtggtcacgcattcctaagattgacaaaattcctgcctga
              
                            

Download fasta file
RegulonDB