RegulonDB RegulonDB 10.9: Gene Sequence
rpoS gene sequence


Size: 993        A: 254  T: 222  G: 292  C: 225

Fasta

 

>rpoS E. coli K12. Version NC_000913.3 GI:556503834
atgagtcagaatacgctgaaagttcatgatttaaatgaagatgcggaatttgatgagaac
ggagttgaggtttttgacgaaaaggccttagtagaacaggaacccagtgataacgatttg
gccgaagaggaactgttatcgcagggagccacacagcgtgtgttggacgcgactcagctt
taccttggtgagattggttattcaccactgttaacggccgaagaagaagtttattttgcg
cgtcgcgcactgcgtggagatgtcgcctctcgccgccggatgatcgagagtaacttgcgt
ctggtggtaaaaattgcccgccgttatggcaatcgtggtctggcgttgctggaccttatc
gaagagggcaacctggggctgatccgcgcggtagagaagtttgacccggaacgtggtttc
cgcttctcaacatacgcaacctggtggattcgccagacgattgaacgggcgattatgaac
caaacccgtactattcgtttgccgattcacatcgtaaaggagctgaacgtttacctgcga
accgcacgtgagttgtcccataagctggaccatgaaccaagtgcggaagagatcgcagag
caactggataagccagttgatgacgtcagccgtatgcttcgtcttaacgagcgcattacc
tcggtagacaccccgctgggtggtgattccgaaaaagcgttgctggacatcctggccgat
gaaaaagagaacggtccggaagataccacgcaagatgacgatatgaagcagagcatcgtc
aaatggctgttcgagctgaacgccaaacagcgtgaagtgctggcacgtcgattcggtttg
ctggggtacgaagcggcaacactggaagatgtaggtcgtgaaattggcctcacccgtgaa
cgtgttcgccagattcaggttgaaggcctgcgccgtttgcgcgaaatcctgcaaacgcag
gggctgaatatcgaagcgctgttccgcgagtaa
              
                            

Download fasta file
RegulonDB