RegulonDB RegulonDB 10.10: Gene Sequence
kdpA gene sequence


Size: 1674        A: 294  T: 451  G: 504  C: 425

Fasta

 

>kdpA E. coli K12. Version NC_000913.3 GI:556503834
atggctgcgcaagggttcttactgatcgccacgtttttactggtgttaatggtgctggcg
cgtcctttaggcagcgggctggcgcggctgattaatgacattcctcttcccggtacaacg
ggcgttgagcgcgtactttttcgcgcacttggcgtctctgaccgtgagatgaactggaag
caatatctttgtgccattctcggcctgaacatgctggggctggcggtgctgttttttatg
ttgctcggtcagcactatctgccgcttaatccacagcagttgccagggctgtcgtgggat
ctggcgctgaataccgccgtcagctttgtcaccaataccaactggcaatcttatagcggt
gaaaccacgttgagctatttcagccagatggcgggcttaacggtgcaaaactttctttct
gccgccagcgggattgcggtgatttttgccctcatccgtgcgtttacccgccagagcatg
agcacgctcgggaatgcctgggtcgatctgctacgcatcacgttatgggtgctagtccct
gtggcgttgttgattgcactgttttttattcaacaaggtgcgctgcaaaactttctgcct
tatcaggctgtgaataccgttgaaggagcgcaacagctgttacccatggggcctgtagct
tctcaggaagcgatcaagatgctcggtactaacggcggtggcttctttaatgccaactcg
tcgcatccgtttgaaaacccaaccgcactgaccaacttcgtgcagatgctggcgatcttc
ttgatcccaacggcgctgtgctttgcctttggtgaagtgatgggcgatcgccgccagggg
cgcatgttgctgtgggcgatgtcagtgatttttgtcatctgcgtaggcgtggtgatgtgg
gcagaagttcagggtaatcctcatctgctggcactgggcacggacagcagcatcaatatg
gaaggtaaagagagccgtttcggcgtgctggtcagtagcctgtttgcggtcgtgacgacg
gcggcttcctgtggcgcggtgattgcgatgcatgattcgtttaccgctctcggtggcatg
gtgccgatgtggctgatgcaaattggtgaagtggtgttcggcggtgtcggttctggtctt
tacggcatgatgctgtttgtcctgctggcggtgtttattgccgggctgatgattggtcgt
acaccggaatatctgggtaaaaaaatcgacgtacgcgagatgaaactgactgcactggca
attctggttaccccgacgctggtgctgatgggcgcggcgttggcgatgatgaccgacgcc
ggacgtagcgccatgctcaaccctggcccgcatggttttagcgaagtgctgtacgccgtg
tcatccgccgctaacaacaacggcagcgcctttgccggattaagcgccaactctccgttc
tggaactgtttactggcgttctgcatgtttgtcggtcgcttcggggtgattatcccggtg
atggcaattgccggttcgctggtgagtaaaaagagccaagccgccagctccggcacgctg
ccaacgcacggcccgctgtttgttggcctgttaatcggcaccgtgttgctggttggcgca
ctgacctttatccctgccctggcgcttggtccggtggcggaatatctctcctga
              
                            

Download fasta file
RegulonDB