RegulonDB RegulonDB 10.9: Gene Sequence
kdpB gene sequence


Size: 2049        A: 433  T: 464  G: 618  C: 534

Fasta

 

>kdpB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcgtaaacaactggcgctattcgaaccaacacttgtcgttcaggcgctgaaagaa
gcggtgaaaaaattaaacccgcaggcgcaatggcgcaatccggtgatgtttatcgtctgg
atcggcagtctgctgaccacctgtattagcatcgcgatggcaagcggtgcgatgcccggc
aatgcgctgtttagcgcggccattagcggttggctgtggatcaccgtactgttcgctaat
ttcgccgaggcgctggcagaaggccgcagtaaagcgcaggccaacagtctgaaaggggtg
aaaaaaactgcctttgcccgcaagctgcgtgagccgaaatatggcgctgcggcggacaaa
gttcctgccgaccaacttcgtaaaggcgatatcgtactggtagaagctggcgatattatc
ccctgcgatggtgaagttattgaagggggtgcatcggtcgatgaaagcgccatcaccggg
gaatcggcaccggtgatccgtgaatccggcggcgattttgcctccgtcaccggcggcacg
cgtattctttctgactggctggtgattgagtgtagcgttaaccccggcgagacatttctg
gatcggatgatcgcgatggtggaaggcgcacagcgacgcaaaacgccgaacgaaattgcc
ctgaccattctgctgattgccctgactatcgtctttttactggcaaccgccacgctgtgg
ccgttttccgcgtggggcggtaatgcagtcagcgtaacggtactggtggcgctgctggtc
tgtctgatcccaaccactattggcggcctgttgtcagcgatcggcgtcgccgggatgagc
cggatgctaggcgcgaatgtgattgccaccagcggacgtgcagttgaagcggcaggtgac
gttgacgttctgctactggataaaaccggcaccatcacactcggtaaccgtcaggcgtcg
gagtttatccccgcgcagggcgtggatgaaaaaacgctggctgacgccgcacaactggct
tcgctggctgatgaaacgccggaaggccgcagtattgtgatcctcgccaagcagcgtttt
aacctgcgcgagcgcgatgtgcagtcgctccatgccacctttgtaccgtttactgcgcaa
agccggatgagcgggatcaacatcgacaaccgcatgatccgtaaaggttctgtcgatgcc
attcgtcgccatgttgaggctaacggtggtcacttccctaccgatgttgatcaaaaagtc
gatcaggttgcgcgtcagggagccacgccgctggtggtggtggaaggttctcgtgtgctg
ggcgttattgcgctgaaagatatcgtcaaaggcggtattaaagagcgcttcgcccagctg
cgcaaaatgggcattaaaacggtgatgattaccggcgataaccgtctgactgccgccgcg
attgctgcggaagcgggtgtcgatgattttctcgccgaagcgacaccggaggccaagctg
gcattgatccgtcagtatcaggcggaaggtcgtttggtagcgatgaccggcgacggcacc
aacgatgctccggcgctggcgcaggcagatgtcgcggtggcgatgaactccggcacccag
gcggcgaaagaggcgggcaatatggtcgatctcgactctaacccgaccaagttgatcgag
gtggtgcacattggcaaacagatgctgatgacccgtggctcgctgaccaccttcagcatt
gccaacgatgtggcgaaatacttcgccattattccggcggcattcgcggcaacgtatccg
cagttaaatgcgctgaacatcatgtgcctgcattcgcccgactccgcaatcctcagtgcg
gtgattttcaacgccttgattatcgtctttttgattcccctggcgttaaaaggcgtgagt
tataaaccgcttaccgcttctgccatgttgcgccgtaacttatggatttacggtctgggt
gggctgctggtgccgtttatcggtatcaaagtcattgatttactgctgaccgtttgcggt
ctggtgtga
              
                            

Download fasta file
RegulonDB