RegulonDB RegulonDB 11.1: Gene Sequence
kdpD gene sequence


Size: 2685        A: 566  T: 573  G: 817  C: 729

Fasta

 

>kdpD E. coli K12. Version NC_000913.3 GI:556503834
atgaataacgaacccttacgtcccgaccccgatcgtctgctggaacaaactgccgcgccg
catcgggggaagctgaaagttttcttcggtgcctgtgcaggcgtcgggaagacctgggcg
atgctggcagaagcccagcgactgcgggcgcaagggctggatattgtggttggcgtggta
gaaacccacgggcgaaaagataccgccgccatgctggaagggctggctgttctgccgtta
aaacgccaggcgtaccgtgggcggcatatcagcgagtttgatctcgatgccgccctcgcc
cgccgcccggcgctgatcttaatggacgaactggcgcacagtaatgcgccaggttcccgt
catcccaaacgctggcaggatatcgaagaactgctggaagctggcattgatgttttcact
accgtcaacgttcagcatctggaaagtctgaatgatgtggtcagcggcgtcaccggaatt
caggtacgggaaaccgtgcccgatccttttttcgatgccgccgacgacgtggtgctggtg
gacttgcccccggacgatctgcgccagcggctgaaagaaggcaaagtctatattgccggg
caggcggagcgcgccattgaacattttttccgcaaaggtaatctgatcgccctgcgcgaa
ctggcactgcgccgtactgccgatcgcgttgatgagcaaatgcgcgcctggcgggggcat
cctggcgaagagaaagtgtggcacacgcgcgacgcgatccttttatgcatcggccataac
accggcagcgaaaaactggtccgcgcagcggcgcggctggcgtcacggctgggtagcgtc
tggcacgcggtgtatgttgaaacccctgccctgcaccgcttaccggaaaaaaaacgtcgg
gcaattctcagcgccttacgtctggcgcaggaactgggcgcggagacggcaacactttct
gatccagcggaagagaaagcggtagtgcgttatgcccgtgaacataatctcggcaagatt
attctcggtcgcccggcctcgcgccgctggtggcgtcgggaaacgtttgctgaccgactg
gcgcgcatcgcccccgatctcgatcaggtgctggtcgcgcttgatgaaccacccgcccgc
acgattaacaacgcgccggataaccgctcttttaaagacaagtggcgtgtacaaattcag
ggatgcgtggttgccgccgcgttatgcgccgttatcaccttaattgccatgcagtggctg
atggcgtttgatgccgccaacctggtgatgctgtatctgcttggcgtggtggtggtggcg
ctattttatggacgctggccttcagtggttgccaccgtcattaatgtagtgagtttcgat
ctcttttttatcgccccacgcggcacgctcgccgtctctgatgtgcaatatctgctgacc
ttcgcggtgatgttaaccgtcgggctggtgatcgggaaccttactgctggcgtgcgttat
caggcgcgggtagcccgttaccgcgagcaacgcacacggcacttatatgaaatgtcgaaa
gctctggcggtgggccgcagtccgcaggatatcgctgccaccagcgaacaatttattgcc
tccacgtttcatgcccgcagtcaggtgttgttgcccgatgacaacggtaaattgcagccg
ttaacacatccgcaaggaatgacgccgtgggacgatgccatcgcgcagtggagttttgat
aaaggcctgcctgcgggcgcgggcaccgacacgttacccggtgtaccgtaccagattttg
ccgctaaaaagcggcgagaaaacctacgggctggtggtggtggagccggggaatctgcgc
cagttgatgatcccggaacagcagcgcctgctggagacgtttacgctgttagtcgccaat
gcccttgagcggctgacgctaaccgccagcgaagaacaggcgcggatggcaagcgaacgt
gaacagatccgcaacgccctgctggcggcgctttcgcatgatttacgcacgccgcttacg
gtgctgtttggtcaggcagaaatcttaacgctcgatctggcaagcgaaggatcaccccac
gcccgccaggccagcgagatccgtcagcatgtgctgaacactacccgactggtgaataat
ctactggatatggcgcgaattcagtccggcggctttaatttgaagaaagagtggttaacg
ctggaagaagtagtcggcagcgcgctgcaaatgctggaaccgggtttatcgtcgcccatc
aatctttctctgccagaaccgctgaccttaatccacgttgacgggccactctttgaacgg
gtgctgattaatctgctggagaacgcggtgaaatatgcgggtgcgcaggccgaaattggt
atcgatgcccacgttgagggcgaaaatctacaactggatgtctgggataacggccccggt
cttccgccaggccaggagcagacgatatttgataagtttgctcgcgggaataaagagtcg
gcagtaccgggggtagggcttggactggcaatttgtcgggcgatagtggatgtacacggg
ggcactattaccgcgttcaaccgaccggaaggtggtgcctgttttcgtgttacacttccc
cagcaaactgcccctgaacttgaagaatttcatgaggatatgtga
              
                            

Download fasta file
RegulonDB