RegulonDB RegulonDB 10.10: Gene Sequence
kgtP gene sequence


Size: 1299        A: 269  T: 397  G: 347  C: 286

Fasta

 

>kgtP E. coli K12. Version NC_000913.3 GI:556503834
atggctgaaagtactgtaacggcagacagcaaactgacaagtagtgatactcgtcgccgc
atttgggcgattgtgggggcctcttcaggtaatctggtcgagtggttcgatttctatgtc
tactcgttctgttcactctactttgcccacatcttcttcccttccgggaacacgacgact
caactactacaaacagcaggtgtttttgctgcgggattcctgatgcgcccaataggcggt
tggctatttggccgcatagccgataaacatggtcgcaaaaaatcgatgctgttatcggtg
tgtatgatgtgtttcggatcgctggttatcgcctgcctcccaggttatgaaactataggt
acgtgggctccggcattattgcttctcgctcgtttatttcagggattatctgttggcgga
gaatatggcaccagcgccacctatatgagtgaagttgccgttgaagggcgcaaaggtttt
tacgcatcatttcagtatgtgacgttgatcggcggacaactgctagccctactggttgtc
gtggttttacaacacaccatggaagacgctgcactcagagagtggggatggcgtattcct
ttcgcgttaggagctgtgttagctgttgtggcgttgtggttacgtcgtcagttagatgaa
acttcgcaacaagaaacgcgcgctttaaaagaagctggatctctgaaaggattatggcgc
aatcgccgtgcattcatcatggttctcggttttaccgctgcgggctccctttgtttctat
accttcactacttatatgcagaagtatctggtaaatactgcgggaatgcatgccaacgtg
gcgagtggcattatgactgccgcattgtttgtattcatgcttattcaaccactcattggc
gcgctgtcggataagattggtcgccgtacctcaatgttatgtttcggttcgctggcagcc
atttttaccgttcctattctctcagcattgcaaaacgtttcctcgccttatgccgctttt
ggtctggtgatgtgtgccctgctgatagtgagtttttatacatcaatcagtggaatactg
aaggctgagatgttcccggcacaggttcgcgcattaggcgttggtctgtcatatgcggtc
gctaatgctatatttggtggttcggcggagtacgtagcgttgtcgctgaaatcaatagga
atggaaacagccttcttctggtatgtgaccttgatggccgtggtggcgtttctggtttct
ttgatgctacatcgcaaagggaaggggatgcgtctttag
              
                            

Download fasta file
RegulonDB