RegulonDB RegulonDB 10.9: Gene Sequence
lacY gene sequence


Size: 1254        A: 240  T: 433  G: 297  C: 284

Fasta

 

>lacY E. coli K12. Version NC_000913.3 GI:556503834
atgtactatttaaaaaacacaaacttttggatgttcggtttattctttttcttttacttt
tttatcatgggagcctacttcccgtttttcccgatttggctacatgacatcaaccatatc
agcaaaagtgatacgggtattatttttgccgctatttctctgttctcgctattattccaa
ccgctgtttggtctgctttctgacaaactcgggctgcgcaaatacctgctgtggattatt
accggcatgttagtgatgtttgcgccgttctttatttttatcttcgggccactgttacaa
tacaacattttagtaggatcgattgttggtggtatttatctaggcttttgttttaacgcc
ggtgcgccagcagtagaggcatttattgagaaagtcagccgtcgcagtaatttcgaattt
ggtcgcgcgcggatgtttggctgtgttggctgggcgctgtgtgcctcgattgtcggcatc
atgttcaccatcaataatcagtttgttttctggctgggctctggctgtgcactcatcctc
gccgttttactctttttcgccaaaacggatgcgccctcttctgccacggttgccaatgcg
gtaggtgccaaccattcggcatttagccttaagctggcactggaactgttcagacagcca
aaactgtggtttttgtcactgtatgttattggcgtttcctgcacctacgatgtttttgac
caacagtttgctaatttctttacttcgttctttgctaccggtgaacagggtacgcgggta
tttggctacgtaacgacaatgggcgaattacttaacgcctcgattatgttctttgcgcca
ctgatcattaatcgcatcggtgggaaaaacgccctgctgctggctggcactattatgtct
gtacgtattattggctcatcgttcgccacctcagcgctggaagtggttattctgaaaacg
ctgcatatgtttgaagtaccgttcctgctggtgggctgctttaaatatattaccagccag
tttgaagtgcgtttttcagcgacgatttatctggtctgtttctgcttctttaagcaactg
gcgatgatttttatgtctgtactggcgggcaatatgtatgaaagcatcggtttccagggc
gcttatctggtgctgggtctggtggcgctgggcttcaccttaatttccgtgttcacgctt
agcggccccggcccgctttccctgctgcgtcgtcaggtgaatgaagtcgcttaa
              
                            

Download fasta file
RegulonDB