RegulonDB RegulonDB 10.9: Gene Sequence
lacZ gene sequence


Size: 3075        A: 678  T: 667  G: 888  C: 842

Fasta

 

>lacZ E. coli K12. Version NC_000913.3 GI:556503834
atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccct
ggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagc
gaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgc
tttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcct
gaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatc
tacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccg
acgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacg
cgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtc
ggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgcc
ggagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaagat
caggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgact
acacaaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgta
ctggaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttct
ttatggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatc
gatgagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaa
ctgtggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgac
ggcacgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaat
ggtctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcat
catcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatg
aagcagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtac
acgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggc
atggtgccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgc
gtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctgggg
aatgaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgat
ccttcccgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatt
tgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtcc
atcaaaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcc
cacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtat
ccccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgat
gaaaacggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgc
cagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaa
gcaaaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgacc
agcgaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggat
ggtaagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttg
attgaactgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgc
gtagtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcag
tggcgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcat
ctgaccaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaac
cgccagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccg
ctgcgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacc
cgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaa
gcagcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgct
cacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgat
ggtagtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccg
gcgcggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcgga
ttagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggat
ctgccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgc
gggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatc
agccgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaa
gaaggcacatggctgaatatcgacggtttccatatggggattggtggcgacgactcctgg
agcccgtcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtc
tggtgtcaaaaataa
              
                            

Download fasta file
RegulonDB