RegulonDB RegulonDB 10.9: Gene Sequence
leuO gene sequence


Size: 945        A: 255  T: 258  G: 224  C: 208

Fasta

 

>leuO E. coli K12. Version NC_000913.3 GI:556503834
atgccagaggtacaaacagatcatccagagacggcggagttaagcaaaccacagctacgc
atggtcgatctcaacttattaaccgttttcgatgccgtgatgcaggagcaaaacattact
cgtgccgctcatgttctgggaatgtcgcaacctgcggtcagtaacgctgttgcacgcctg
aaggtgatgtttaatgacgagctttttgttcgttatggccgtggtattcaaccgactgct
cgcgcatttcaactttttggttcagttcgtcaggcattgcaactagtacaaaatgaattg
cctggttcaggttttgaacccgcgagcagtgaacgtgtatttcatctttgtgtttgcagc
ccgttagacagcattctgacctcgcagatttataatcacattgagcagattgcgccaaat
atacatgttatgttcaagtcttcattaaatcagaacactgaacatcagctgcgttatcag
gaaacggagtttgtgattagttatgaagacttccatcgtcctgaatttaccagcgtacca
ttatttaaagatgaaatggtgctggtagccagcaaaaatcatccaacaattaagggcccg
ttactgaaacatgatgtttataacgaacaacatgcggcggtttcgctcgatcgtttcgcg
tcatttagtcaaccttggtatgacacggtagataagcaagccagtatcgcgtatcagggc
atggcaatgatgagcgtacttagcgtggtgtcgcaaacgcatttggtcgctattgcgccg
cgttggctggctgaagagttcgctgaatccttagaattacaggtattaccgctgccgtta
aaacaaaacagcagaacctgttatctctcctggcatgaagctgccgggcgcgataaaggc
catcagtggatggaagagcaattagtctcaatttgcaaacgctaa
              
                            

Download fasta file
RegulonDB