RegulonDB RegulonDB 10.9: Gene Sequence
leuS gene sequence


Size: 2583        A: 661  T: 544  G: 724  C: 654

Fasta

 

>leuS E. coli K12. Version NC_000913.3 GI:556503834
atgcaagagcaataccgcccggaagagatagaatccaaagtacagcttcattgggatgag
aagcgcacatttgaagtaaccgaagacgagagcaaagagaagtattactgcctgtctatg
cttccctatccttctggtcgactacacatgggccacgtacgtaactacaccatcggtgac
gtgatcgcccgctaccagcgtatgctgggcaaaaacgtcctgcagccgatcggctgggac
gcgtttggtctgcctgcggaaggcgcggcggtgaaaaacaacaccgctccggcaccgtgg
acgtacgacaacatcgcgtatatgaaaaaccagctcaaaatgctgggctttggttatgac
tggagccgcgagctggcaacctgtacgccggaatactaccgttgggaacagaaattcttc
accgagctgtataaaaaaggcctggtatataagaagacttctgcggtcaactggtgcccg
aacgaccagaccgtactggcgaacgaacaagttatcgacggctgctgctggcgctgcgat
accaaagttgaacgtaaagagatcccgcagtggtttatcaaaatcactgcttacgctgac
gagctgctcaacgatctggataaactggatcactggccagacaccgttaaaaccatgcag
cgtaactggatcggtcgttccgaaggcgtggagatcaccttcaacgttaacgactatgac
aacacgctgaccgtttacactacccgcccggacacctttatgggttgtacctacctggcg
gtagctgcgggtcatccgctggcgcagaaagcggcggaaaataatcctgaactggcggcc
tttattgacgaatgccgtaacaccaaagttgccgaagctgaaatggcgacgatggagaaa
aaaggcgtcgatactggctttaaagcggttcacccattaacgggcgaagaaattcccgtt
tgggcagcaaacttcgtattgatggagtacggcacgggcgcagttatggcggtaccgggg
cacgaccagcgcgactacgagtttgcctctaaatacggcctgaacatcaaaccggttatc
ctggcagctgacggctctgagccagatctttctcagcaagccctgactgaaaaaggcgtg
ctgttcaactctggcgagttcaacggtcttgaccatgaagcggccttcaacgccatcgcc
gataaactgactgcgatgggcgttggcgagcgtaaagtgaactaccgcctgcgcgactgg
ggtgtttcccgtcagcgttactggggcgcgccgattccgatggtgacgctggaagacggt
accgtaatgccgaccccggacgaccagctgccggtgatcctgccggaagatgtggtaatg
gacggcattaccagcccgattaaagcagatccggagtgggcgaaaactaccgttaacggt
atgccagcactgcgtgaaaccgacactttcgacacctttatggagtcctcctggtactat
gcgcgctacacttgcccgcagtacaaagaaggtatgctggattccgaagcggctaactac
tggctgccggtggatatctacattggtggtattgaacacgccattatgcacctgctctac
ttccgcttcttccacaaactgatgcgtgatgcaggcatggtgaactctgacgaaccagcg
aaacagttgctgtgtcagggtatggtgctggcagatgccttctactatgttggcgaaaac
ggcgaacgtaactgggtttccccggttgatgctatcgttgaacgtgacgagaaaggccgt
atcgtgaaagcgaaagatgcggcaggccatgaactggtttataccggcatgagcaaaatg
tccaagtcgaagaacaacggtatcgacccgcaggtgatggttgaacgttacggcgcggac
accgttcgtctgtttatgatgtttgcttctccggctgatatgactctcgaatggcaggaa
tccggtgtggaaggggctaaccgcttcctgaaacgtgtctggaaactggtttacgagcac
acagcaaaaggtgatgttgcggcactgaacgttgatgcgctgactgaaaatcagaaagcg
ctgcgtcgcgatgtgcataaaacgatcgctaaagtgaccgatgatatcggccgtcgtcag
accttcaacaccgcaattgcggcgattatggagctgatgaacaaactggcgaaagcacca
accgatggcgagcaggatcgcgctctgatgcaggaagcactgctggccgttgtccgtatg
cttaacccgttcaccccgcacatctgcttcacgctgtggcaggaactgaaaggcgaaggc
gatatcgacaacgcgccgtggccggttgctgacgaaaaagcgatggtggaagactccacg
ctggtcgtggtgcaggttaacggtaaagtccgtgccaaaatcaccgttccggtggacgca
acggaagaacaggttcgcgaacgtgctggccaggaacatctggtagcaaaatatcttgat
ggcgttactgtacgtaaagtgatttacgtaccaggtaaactcctcaatctggtcgttggc
taa
              
                            

Download fasta file
RegulonDB