RegulonDB RegulonDB 10.8: Gene Sequence
ligA gene sequence


Size: 2016        A: 462  T: 457  G: 614  C: 483

Fasta

 

>ligA E. coli K12. Version NC_000913.3 GI:556503834
atggaatcaatcgaacaacaactgacagaactgcgaacgacgcttcgccatcatgaatat
ctttatcatgtgatggatgcgccggaaattcccgacgctgaatacgacaggctgatgcgc
gaactgcgcgagctggaaaccaaacatccagaactgattacgcctgattcgcctactcaa
cgtgtaggcgctgcgccgctggcggctttcagccagatacgccatgaagtaccaatgctg
tcactggataacgtttttgatgaagaaagctttcttgctttcaacaaacgtgtgcaggac
cgtctgaaaaacaacgagaaagtcacctggtgctgtgagctgaagctggatggtcttgcc
gtcagtattctgtatgaaaatggcgttttagtcagtgccgcgacccgtggcgatggcacc
accggggaagatatcacgtctaatgtgcgtactattcgcgccattccgctgaagctgcac
ggagagaatatcccggcgcgtctggaagtgcgtggtgaagtgttcctgccgcaggcgggg
ttcgaaaagattaacgaagatgcgcgacgcacgggcgggaaagtgtttgctaacccacgt
aatgcggcagctggttcactgcgtcagcttgatccgcgtattacagcgaagcgaccgctc
acttttttctgctatggcgttggtgttctggaaggtggcgagctgccggatactcatctt
ggccgtttactgcaatttaaaaagtgggggttgccggtcagcgatcgggtaacgctttgt
gaatcggcggaagaagtgctggcgttctatcacaaagtggaagaagaccgcccgacgctg
ggctttgatatcgacggcgtggtgattaaggtcaactcactggcacagcaggagcagctt
ggctttgtcgcgcgtgccccgcgctgggcggtagcgtttaaattcccggcgcaggagcag
atgacctttgtgcgtgacgtcgagtttcaggttgggcgtactggcgcgattacgcctgtt
gcgcgtctggaacctgtccatgttgcaggcgtgctggtgagtaacgcaaccttacacaat
gcggatgaaatcgaacgtcttggtttacgcattggcgataaagtggtgattcgccgcgct
ggcgacgtgatcccgcaggtggttaacgtcgtgctttctgaacgcccggaagatacccgt
gaggttgtattcccgacgcattgtccggtatgtggttctgacgttgagcgtgtggaaggt
gaagcggttgcccgctgtaccggtggcctgatttgcggtgcgcagcgtaaagagtcgctg
aaacactttgtttcccgccgtgcgatggatgttgacggaatgggcgacaaaatcatcgat
cagctggttgaaaaagaatatgtccatactccggcagatctgttcaaactcaccgcaggc
aaactgaccggactggagcgtatggggccaaaatcggcacaaaacgtggttaacgcgctg
gaaaaagcgaaagaaaccacctttgctcgcttcctctatgcacttggcatccgtgaagtc
ggcgaggccaccgcagcaggtctggcggcatatttcggcacgctggaagcgctggaagcc
gcttcgattgaagagctgcaaaaggtgcctgatgttggcattgtcgttgcatcccacgtt
cacaacttctttgccgaagaaagcaaccgcaatgtcatcagcgagctgttggcggaaggt
gttcactggcctgcgccgatcgttatcaacgcggaagagattgacagcccgtttgctggt
aaaaccgtggtgcttacgggcagcttaagccagatgtcgcgtgatgacgctaaagctcga
ctggtcgaactgggcgcgaaagtcgcgggcagcgtgtcgaagaaaaccgatctggtgata
gcgggtgaagctgcaggatctaaactggcgaaggcgcaggaactgggcattgaagtcatc
gacgaagcggaaatgctgcgtttgctgggtagctga
              
                            

Download fasta file
RegulonDB