RegulonDB RegulonDB 10.9: Gene Sequence
lit gene sequence


Size: 894        A: 294  T: 271  G: 168  C: 161

Fasta

 

>lit E. coli K12. Version NC_000913.3 GI:556503834
atgcgctcaccaatttgtcatcttttctcagcaattaattcatcaccatttaagattgca
ccagagaaggagcaagatcttaaaacgatagttgacgacaaaaaaattataatttcagtt
gtgagtgaacctggttttaatatccgagtcaggaagaatgagagtaataattcacatgaa
atagttctaacagtagcttcacttgaatatatttgggcattttccaatttcttttgggtt
tttacgcaagagtactccaaatctcagaaaaataatgatgagcactttgatttaacagga
aaaaataggcttaaaaagtctgatgaacttcttaaatgggcaaggaaaaacttgcaaaca
acaggttgcgaatcatggcctaaaaaatgtcccaagccagaagcatatttacaaggaagc
gaagactcacaagttgctagcgagatatttctttgtgctattgcttggattcttcatcat
gaaataagtcatgttgttttacagcatccattggtcactacagcattctccactcaagag
gagcgtgaagcagattcacatgctacaaaatggatattaggcaacctgtatgaatccgct
cctgaattaaagaaacgtgcacttggcattgctacggcagtgctttgtatacaaagctta
gaagttgaaaattacttctgtttacaaaatacacacccagctgcatatgagcgtatatat
tcgaatatttcatgctaccctgtcggaaatgaagagttgattgaagctctatgtacagtg
atgcttcaatatcttttccatggcaaaaatatcaatgtgaatctagatggggagtccttt
tcatcgattttaggtgatcttctctgtgatatttcacgtcttaccagtaactga
              
                            

Download fasta file
RegulonDB