RegulonDB RegulonDB 10.9: Gene Sequence
lpxB gene sequence


Size: 1149        A: 264  T: 267  G: 335  C: 283

Fasta

 

>lpxB E. coli K12. Version NC_000913.3 GI:556503834
atgactgaacagcgtccattaacgattgccctggtcgccggagaaacctccggcgatatc
ctgggggccggtttaatccgcgctctgaaagaacatgtgcccaacgcccgctttgttggt
gttgccgggccacgaatgcaggctgaaggctgcgaagcctggtacgaaatggaagaactg
gcggtgatgggcattgttgaagtgctcggtcgtctgcgtcgcttactgcatattcgtgcc
gatctgacaaagcgttttggcgaactgaagccagatgtttttgttggtattgatgcgcct
gacttcaatattactcttgaaggtaacctcaaaaagcagggtatcaaaaccattcattac
gtcagtccgtcagtctgggcgtggcgacagaaacgtgttttcaaaataggcagagccacc
gatctggtgctcgcatttctgcctttcgaaaaagcgttttatgacaaatacaacgtaccg
tgccgctttatcggtcataccatggctgatgccatgccattagatccagataaaaatgcc
gcccgtgatgtgctggggatccctcacgatgcccactgcctggcgttgctaccggggagc
cgtggtgcagaagttgaaatgcttagtgccgatttcctgaaaacggcccagcttttgcgc
cagacatatccggatctcgaaatcgtggtgccactggtgaatgccaaacgccgcgagcag
tttgaacgcatcaaagctgaagtcgcgccagacctttcagttcatttgctggatgggatg
ggccgtgaggcgatggtcgccagcgatgcggcgctactggcgtcgggtacggcagccctg
gagtgtatgctggcgaaatgcccgatggtggtgggatatcgcatgaagccttttaccttc
tggttggcgaagcggctggtgaaaactgattatgtctcgctgccaaatctgctggcgggc
agagagttagtcaaagaattattgcaggaagagtgtgagccgcaaaaactggctgcggcg
ctgttaccgctgttggcgaacgggaaaaccagccacgcgatgcacgataccttccgtgaa
ctgcatcagcagatccgctgcaatgccgatgagcaggcggcacaagccgttctggagtta
gcacaatga
              
                            

Download fasta file
RegulonDB