RegulonDB RegulonDB 10.9: Gene Sequence
lrp gene sequence


Size: 495        A: 127  T: 131  G: 128  C: 109

Fasta

 

>lrp E. coli K12. Version NC_000913.3 GI:556503834
atggtagatagcaagaagcgccctggcaaagatctcgaccgtatcgatcgtaacattctt
aatgagttgcaaaaggatgggcgtatttctaacgtcgagctttctaaacgtgtgggactt
tccccaacgccgtgccttgagcgtgtgcgtcggctggaaagacaagggtttattcagggc
tatacggcgctgcttaacccccattatctggatgcatcacttctggtattcgttgagatt
actctgaatcgtggcgcaccggatgtgtttgaacaattcaataccgctgtacaaaaactt
gaagaaattcaggagtgtcatttagtatccggtgatttcgactacctgttgaaaacacgc
gtgccggatatgtcagcctaccgtaagttgctgggggaaaccctgctgcgtctgcctggc
gtcaatgacacacggacatacgttgttatggaagaagtcaagcagagtaatcgtctggtt
attaagacgcgctaa
              
                            

Download fasta file
RegulonDB