RegulonDB RegulonDB 10.9: Gene Sequence
lysR gene sequence


Size: 936        A: 202  T: 234  G: 247  C: 253

Fasta

 

>lysR E. coli K12. Version NC_000913.3 GI:556503834
atggccgccgttaacttacgtcatattgaaatttttcatgcggtaatgaccgccggaagc
ctgactgaggcggcacacctgctacacacctcacagccaaccgtcagccgcgaacttgcg
cgctttgagaaggtgatcgggctgaaattgtttgagcgcgtacgtgggcgattacatcct
accgtgcaaggactgcgtctgtttgaagaagtgcaacgatcctggtacggactggatcgc
attgtcagcgccgcagaaagtctgcgcgagtttcgccagggagaactgtctattgcctgc
ctgccggtcttttcgcaatcttttttaccgcagctcctgcaaccctttctggcacgttat
cccgatgtcagcttaaatatcgtgccccaggaatcaccgctacttgaagagtggctctcg
gcccagcgtcatgatttaggactcactgaaacgctccatacgcctgcgggaacagaacgt
accgaattactctctttagatgaagtgtgtgtgttacctccgggtcatccgctggcggta
aaaaaggtattaacgccggatgattttcagggtgagaactacatcagcctttcccgtact
gacagctatcgccagttgctggatcagctatttactgaacatcaggttaaacgacgcatg
atcgtagaaacccacagcgccgcgtcagtctgcgcaatggtacgggcgggggtaggtatt
tcggtggttaacccgctcaccgcactagattatgcggcaagcggtttagtggtgcggcgg
ttcagtattgcggttccgttcaccgtcagcctgatccgccccctgcaccgcccgtcatca
gcgctggttcaggcgtttagtgggcatttacaagcggggttaccgaaactggtcacttct
cttgacgctattttgtcgtcagctacgacagcataa
              
                            

Download fasta file
RegulonDB