RegulonDB RegulonDB 10.9: Gene Sequence
malI gene sequence


Size: 1029        A: 233  T: 241  G: 307  C: 248

Fasta

 

>malI E. coli K12. Version NC_000913.3 GI:556503834
atggctaccgccaaaaaaataaccattcatgatgttgcgctggctgcgggcgtgtcggta
agtaccgtttcgctggtgcttagtggcaaagggcgaatctctaccgccacaggagaacgc
gttaacgccgccattgaagagctgggatttgtgcgcaatcgccaggcgtcggcgctgcgc
ggcgggcaaagcggcgtcattggtttgatcgtccgtgatttatctgcgccgttttacgcc
gaattgacggccggattgacggaagctctggaagcgcagggacggatggtttttttgctt
cacggcggtaaagacggtgagcagctggcacagcggttttcactgttactgaatcagggt
gtcgatggtgtggtaattgccggagctgcaggaagtagcgatgacctgcgacggatggca
gaagaaaaagctatcccggtgattttcgcttcccgtgccagttatcttgatgatgttgat
acggttcgcccggacaacatgcaggctgcacagttgttgacggagcatctcattcgcaat
gggcatcagcggatcgcctggctgggagggcaaagttcctcattaacccgtgcagaacgg
gttgggggctattgtgcaactctactaaaatttggcctgccgtttcatagcgattgggtg
ttggagtgcacttccagccagaagcaagccgcggaagctatcacggcgcttttacgtcat
aacccgaccatcagtgccgtggtttgctataacgaaactattgcgatgggggcatggttt
ggtttgctcaaagcagggcggcaaagcggggaaagcggagtcgatcgttactttgagcaa
caggtttcgctggcggcatttaccgatgcgacaccaaccacacttgatgatatacctgtt
acctgggccagcacgccagcgcgggaacttggtatcacacttgcggatcgcatgatgcaa
aaaatcacccatgaagagacgcattcacgcaatcttattattcccgcccggctcattgca
gcgaaataa
              
                            

Download fasta file
RegulonDB