RegulonDB RegulonDB 10.10: Gene Sequence
malT gene sequence


Size: 2706        A: 655  T: 587  G: 739  C: 725

Fasta

 

>malT E. coli K12. Version NC_000913.3 GI:556503834
atgctgattccgtcaaaactaagtcgtccggttcgactcgaccataccgtggttcgtgag
cgcctgctggctaaactttccggcgcgaacaacttccggctggcgctgatcacgagtcct
gcgggctacggaaagaccaccctcatttcccagtgggcggcaggcaaaaacgatatcggc
tggtactcgctggatgaaggtgataaccagcaagagcgtttcgccagctatctcattgcc
gccgtgcagcaggcaaccaacggtcactgtgcgatatgtgagacgatggcgcaaaaacgg
caatatgccagcctgacgtcactcttcgcccagcttttcattgagctggcggaatggcat
agcccactttatctggtcatcgatgactatcatctgatcactaatccagtgatccacgag
tcaatgcgcttctttattcgccatcaaccagaaaatctcaccctggtggtgttgtcacgc
aaccttccgcaactgggcattgccaatctgcgtgttcgtgatcaactgctggaaattggc
agtcagcaactggcatttacccatcaggaagcgaagcagttttttgattgccgtctgtca
tcgccgattgaagccgcagaaagcagtcggatttgcgatgacgtttccggttgggcgacg
gcactacagctaatcgccctctccgcccggcagaatacccactcagcccataagtcggca
cgccgcctggcgggaatcaatgccagccatctttcggattatctggtcgatgaggttttg
gataacgtcgatctcgcaacgcgccattttctgttgaaaagcgccattttgcgctcaatg
aacgatgccctcatcacccgtgtgaccggcgaagaaaacgggcaaatgcgcctcgaagag
attgagcgtcaggggctgtttttacagcggatggatgataccggcgagtggttctgctat
cacccgctgtttggtaacttcctgcgccagcgctgccagtgggaactggcggcggagctg
ccggaaatccaccgtgccgccgcagaaagctggatggcccagggatttcccagcgaagca
attcatcatgcgctggcggcaggcgatgcgctgatgctgcgcgatattctgcttaatcac
gcctggagtctgttcaaccatagcgaactgtcgctgctggaagagtcgcttaaggccctg
ccgtgggacagcttgctggaaaatccgcagttggtgttattgcaggcgtggctgatgcaa
agccaacatcgctacggcgaagttaacaccctgctagcccgtgctgaacatgaaatcaag
gacatcagagaagacaccatgcacgcagaatttaacgctctgcgcgcccaggtggcgatt
aacgatggtaatccggatgaagcggaacggctggcaaaactggcactggaagagctgccg
ccgggctggttctatagccgcattgtggcaacctcggtgctgggtgaagtgctgcactgc
aaaggcgaattgacccgctcactggcgctaatgcagcaaaccgaacagatggcacgccag
cacgatgtctggcactacgctttgtggagtttaatccagcaaagtgaaattctgtttgcc
caagggttcctgcaaaccgcgtgggaaacgcaggaaaaagcattccagctgatcaacgag
cagcatctggaacagctgccaatgcatgagtttctggtgcgcattcgtgcgcagctgtta
tgggcctgggcgcggctggatgaagccgaagcgtcggcgcgtagcgggattgaagtcttg
tcgtcttatcagccacagcaacagcttcagtgcctggcaatgttgattcaatgctcgctg
gcccgtggtgatttagataacgcccgtagccagctgaaccgtctggaaaacctgctgggg
aatggcaaatatcacagcgactggatctctaacgccaacaaagtccgggtgatttactgg
caaatgaccggcgataaagccgccgctgccaactggttgcgtcatacggctaaaccagag
tttgcgaacaaccacttcctgcaaggtcaatggcgcaacattgcccgtgcacaaatcttg
ctgggcgagtttgaaccggcagaaattgttctcgaagaactcaatgaaaatgcccggagt
ctgcggttgatgagcgatctcaaccgtaacctgttgctgcttaatcaactgtactggcag
gccggacgtaaaagtgacgcccagcgcgtgttgctggacgcattaaaactggcgaatcgc
accggatttatcagccattttgtcatcgaaggcgaagcgatggcgcaacaactgcgtcag
ctgattcagcttaatacgctgccggaactggaacagcatcgcgcgcagcgtattctgcga
gaaatcaatcaacatcatcggcataaattcgcccatttcgatgagaatttcgttgaacgt
ctgctaaatcatcctgaagtacctgaactgatccgcaccagcccgctgacgcaacgtgaa
tggcaggtactggggctgatctactctggttacagcaatgagcaaattgccggagaactg
gaagtcgcggcaaccaccatcaaaacgcatatccgcaatctgtatcagaaactcggcgtg
gcccatcgccaggatgcggtacaacacgcccagcaattgctgaagatgatggggtacggc
gtgtaa
              
                            

Download fasta file
RegulonDB