RegulonDB RegulonDB 10.9: Gene Sequence
malX gene sequence


Size: 1593        A: 324  T: 429  G: 422  C: 418

Fasta

 

>malX E. coli K12. Version NC_000913.3 GI:556503834
atgacggcgaaaacagcaccgaaagtcacgctgtgggagttcttccagcagttaggcaaa
accttcatgttacccgtggcattattgtcgttctgcggcattatgctcggcattggtagt
tctcttagcagccatgatgtcataaccctgatcccggtcctgggcaaccccgtgttgcag
gctatctttacctggatgagtaagattggctcgtttgcttttagtttcctgcctgtcatg
ttctgtatcgccatcccgctgggcctggcacgcgaaaataaaggcgtagcggcattcgct
ggcttcatcggttatgcggtaatgaacctcgcggtaaacttctggttgaccaataaaggc
attctgccaaccacggatgccgcggttctgaaagccaataacatccagagcattcttggg
atccagtcgatcgataccgggatcctcggtgcggtgatcgccggtattatcgtctggatg
ctgcatgagcgtttccataatatccgcctgccggatgcgctggcattcttcggcggtacg
cgcttcgtaccaattatctcctcgctggtgatgggccttgtcggcctggtgattccatta
gtctggccgattttcgccatgggtattagcggcttgggccatatgataaacagcgcgggt
gatttcggaccgatgctgtttggtaccggtgaacgtctgctgttgccgtttggtctgcat
cacattctggtggcattaattcgctttaccgacgcaggcggcacgcaggaagtctgcggt
caaaccgtcagcggcgcactgaccatcttccaggcgcaattgagttgcccgaccactcac
ggtttttctgaaagcgccacgcgtttcctttcgcaaggtaaaatgcctgcgtttctcggc
ggtctgccaggtgcagcgttagctatgtatcactgcgcgcgcccggaaaatcgccataaa
attaaaggtctgctgatttctggcctgatcgcctgcgtcgttggcggcactaccgaaccg
ctggaattcctgttcctgttcgtagcgccagttctgtatgtcatccacgcgctgttaacc
ggcctcggcttcaccgtcatgtctgtgctcggcgtcaccatcggtaataccgacggcaat
atcatcgacttcgtggtgttcggtattttgcatggtctgtcaaccaagtggtacatggtg
ccagtggtggcggcaatctggtttgtcgtttactacgtcatcttccgtttcgctatcacc
cgcttcaatctgaaaaccccggggcgcgatagcgaagttgccagctcaatcgaaaaagcc
gttgccggtgcgccgggtaaatcaggttacaacgttcctgcaatcctcgaagcattaggc
ggtgccgacaatattgtcagcctcgataactgcattacccgtctgcgtttgtctgtgaaa
gatatgtcgcttgttaatgtgcaggcactgaaggacaatcgggcaattggcgtagtacaa
cttaatcaacataacctgcaggttgttatcgggccacaagttcagtcagtaaaagatgaa
atggccggtctgatgcatactgtccaggcataa
              
                            

Download fasta file
RegulonDB