RegulonDB RegulonDB 10.9: Gene Sequence
manX gene sequence


Size: 972        A: 271  T: 212  G: 259  C: 230

Fasta

 

>manX E. coli K12. Version NC_000913.3 GI:556503834
gtgaccattgctattgttataggcacacatggttgggctgcagagcagttgcttaaaacg
gcagaaatgctgttaggcgagcaggaaaacgtcggctggatcgatttcgttccaggtgaa
aatgccgaaacgctgattgaaaagtacaacgctcagttggcaaaactcgacaccactaaa
ggcgtgctgtttctcgttgatacatggggaggcagcccgttcaatgctgccagccgcatt
gtcgtcgacaaagagcattatgaagtcattgcaggcgttaacattccaatgctcgtggaa
acgttaatggcccgtgatgatgacccaagctttgatgaactggtggcactggcagtagaa
acaggccgtgaaggcgtgaaagcactgaaagccaaaccggttgaaaaagccgcgccagca
cccgctgccgcagcaccaaaagcggctccaactccggcaaaaccaatggggccaaacgac
tacatggttattggccttgcgcgtatcgacgaccgtctgattcacggtcaggtcgccacc
cgctggaccaaagaaaccaatgtctcccgtattattgttgttagtgatgaagtggctgcg
gataccgttcgtaagacactgctcacccaggttgcacctccgggcgtaacagcacacgta
gttgatgttgccaaaatgattcgcgtctacaacaacccgaaatatgctggcgaacgcgta
atgctgttatttaccaacccaacagatgtagagcgtctcgttgaaggcggcgtgaaaatc
acctctgttaacgtcggtggtatggcattccgtcagggtaaaacccaggtgaataacgcg
gtttcggttgatgaaaaagatatcgaggcgttcaagaaactgaatgcgcgcggtattgag
ctggaagtccgtaaggtttccaccgatccgaaactgaaaatgatggatctgatcagcaaa
atcgataagtaa
              
                            

Download fasta file
RegulonDB