RegulonDB RegulonDB 10.9: Gene Sequence
manY gene sequence


Size: 801        A: 162  T: 226  G: 212  C: 201

Fasta

 

>manY E. coli K12. Version NC_000913.3 GI:556503834
atggagattaccactcttcaaattgtgctggtatttatcgtagcctgtatcgcaggtatg
ggatcaatcctcgatgaatttcagtttcaccgtccgctaatcgcgtgtaccctggtgggt
atcgttcttggggatatgaaaaccggtattattatcggtggtacgctggaaatgatcgcg
ctgggctggatgaacatcggtgctgcagttgcgcctgacgccgctctggcttctatcatt
tctaccattctggttatcgcaggtcatcagagcattggtgcaggtatcgcactggcaatc
cctctggccgctgcgggccaggtactgaccatcatcgttcgtactattaccgttgctttc
cagcacgctgcggataaggctgctgataacggcaacctgacagcgatttcctggatccac
gtttcttctctgttcctgcaagcaatgcgtgtggctattccggccgtcatcgttgcgctg
tctgttggtaccagcgaagtacagaacatgctgaatgcgattccggaagtggtgaccaat
ggtctgaatatcgccggtggcatgatcgtggtggttggttatgcgatggttatcaacatg
atgcgtgctggctacctgatgccgttcttctacctcggcttcgtaaccgcagcattcacc
aactttaacctggttgctctgggtgtgattggtactgttatggcagtgctctacatccaa
cttagcccgaaatacaaccgcgtagccggtgcgcctgctcaggcagctggtaacaacgat
ctcgataacgaactggactaa
              
                            

Download fasta file
RegulonDB