RegulonDB RegulonDB 10.9: Gene Sequence
manZ gene sequence


Size: 852        A: 180  T: 223  G: 228  C: 221

Fasta

 

>manZ E. coli K12. Version NC_000913.3 GI:556503834
atggttgatacaactcaaactaccaccgagaaaaaactcactcaaagtgatattcgtggc
gtcttcctgcgttctaacctcttccagggttcatggaacttcgaacgtatgcaggcactg
ggtttctgcttctctatggtaccggcaattcgtcgcctctaccctgagaacaacgaagct
cgtaaacaagctattcgccgtcacctggagttctttaacacccagccgttcgtggctgcg
ccgattctcggcgtaaccctggcgctggaagaacagcgtgctaatggcgcagagatcgac
gacggtgctatcaacggtatcaaagtcggtttgatggggccactggctggtgtaggcgac
ccgatcttctggggaaccgtacgtccggtatttgcagcactgggtgccggtatcgcgatg
agcggcagcctgttaggtccgctgctgttcttcatcctgtttaacctggtgcgtctggca
acccgttactacggcgtagcgtatggttactccaaaggtatcgatatcgttaaagatatg
ggtggtggcttcctgcaaaaactgacggaaggggcgtctatcctcggcctgtttgtcatg
ggggcattggttaacaagtggacacatgtcaacatcccgctggttgtctctcgcattact
gaccagacgggcaaagaacacgttactactgtccagactattctggaccagttaatgcca
ggcctggtaccactgctgctgacctttgcttgtatgtggctactgcgcaaaaaagttaac
ccgctgtggatcatcgttggcttcttcgtcatcggtatcgctggttacgcttgcggcctg
ctgggactgtaa
              
                            

Download fasta file
RegulonDB