RegulonDB RegulonDB 10.9: Gene Sequence
menD gene sequence


Size: 1671        A: 354  T: 346  G: 510  C: 461

Fasta

 

>menD E. coli K12. Version NC_000913.3 GI:556503834
atgtcagtaagcgcatttaaccgacgctgggcggcggtcattctggaagcattaacgcgt
cacggcgtcagacacatctgtatcgccccaggctcgcgttctacaccgttaacgttagcg
gcggcggagaattccgcattcattcaccacacccatttcgatgagcgtgggttggggcat
ctggcgctggggctggcgaaagtcagcaagcagccggtggcggtgattgtgacctccggc
acggcggtggcaaatctctatccggcactgattgaagccgggttaaccggagaaaaactg
attctcttaaccgccgatcgcccgccggagctaattgactgcggcgcgaatcaggcaatt
cgccagccgggaatgttcgcctctcaccccacgcacagtatttcattgccgcgcccgacc
caggatatccccgcacgttggctggtttctaccatcgaccacgctctcggtacgcttcat
gcggggggagtccatatcaactgcccgtttgctgaaccgctgtatggcgaaatggacgat
accgggcttagctggcaacagcgtctgggtgactggtggcaggacgacaaaccgtggctg
cgtgaagcgcctcgtctggaaagtgaaaaacagcgcgactggttcttctggcgacaaaag
cgcggcgtggtggttgccgggcgcatgagtgcggaagagggcaaaaaagttgccctgtgg
gcgcaaactcttggctggccgctgattggcgatgtgctgtcacaaaccgggcagccgctg
ccgtgtgccgatctttggttaggcaatgccaaagcgaccagcgagctgcagcaggcgcaa
attgtggtgcaactgggaagcagcctgacggggaaacggctcctgcaatggcaggcaagc
tgtgaaccagaagagtactggattgttgatgacattgaagggcgacttgatccggcacac
catcgcggacgtcgcttaattgccaatattgccgactggctggagctgcatccggcagaa
aaacgccagccctggtgcgttgaaatcccgcgcctggcggaacaggcaatgcaggcggtt
attgcccgccgtgatgcgtttggcgaagcgcaactggcgcatcgcatctgcgactatctg
cctgaacaggggcaattgtttgttggtaacagcctggtggtacgtctgattgatgcgctt
tcgcaacttccggcaggttacccggtgtacagcaaccgtggggccagcggtatcgacggg
ctgctttcgaccgccgccggcgttcagcgggcaagcggcaaaccgacgctggcgattgtg
ggcgatctctccgcactttacgatctcaacgcgctggcgttattgcgtcaggtttctgcg
ccgctggtattaattgtggtgaacaacaacggcgggcaaattttctcgctgttgccaacg
ccgcaaagcgagcgtgagcgtttctatctgatgccgcaaaacgtccattttgagcacgcc
gccgcgatgttcgagctgaaatatcatcgtccgcaaaactggcaggaacttgaaacggca
tttgccgacgcctggcgcacgccaaccaccacggtgattgaaatggtggttaacgacacc
gatggtgcgcaaacgctccagcaacttctggcgcaggtaagccatttatga
              
                            

Download fasta file
RegulonDB