RegulonDB RegulonDB 10.8: Gene Sequence
mepA gene sequence


Size: 825        A: 186  T: 182  G: 226  C: 231

Fasta

 

>mepA E. coli K12. Version NC_000913.3 GI:556503834
atgaataaaaccgcgattgcgctgctggctctgcttgccagtagcgccagcctggcagcg
acgccgtggcaaaaaataacccaacctgtgccgggtagcgcacaatcgataggcagtttt
tctaatggctgtattgtcggcgctgacacgctgccgatacagtccgaacattatcaggtc
atgcgtaccgatcagcgtcgctatttcggtcacccggatctggtgatgtttatccagcgt
ctgagtagccaggtgagcaatctgggcatgggtacggtgctgattggcgatatggggatg
cccgctggtgggcgtttcaacggcggtcatgccagccaccagaccggactggatgtcgat
atctttctgcaactgccgaaaactcgctggacctccgcgcagctcttgcgcccgcaagca
ctggacttagtttcccgcgacggtaaacacgttgtctccacgctgtggaagccagaaatt
ttcagcttgatcaaactcgccgcccaggacaaagacgtcacgcgcatttttgttaatccg
gcgattaaacaacaactttgccttgatgcgggcaccgatcgcgactggttgcgcaaagtg
cgaccctggttccagcatcgcgcgcatatgcatgtacgattacgttgccctgccgatagt
ctggagtgtgaagatcaacctttaccgccatcaggcgatggttgcggggcagaactgcaa
agctggtttgaacctccaaaaccgggaacaacaaagcctgagaagaagacaccgcctccg
ttgccgccttcctgccaggcgctactggatgagcacgtgatctaa
              
                            

Download fasta file
RegulonDB