RegulonDB RegulonDB 10.10: Gene Sequence
metA gene sequence


Size: 930        A: 223  T: 242  G: 225  C: 240

Fasta

 

>metA E. coli K12. Version NC_000913.3 GI:556503834
atgccgattcgtgtgccggacgagctacccgccgtcaatttcttgcgtgaagaaaacgtc
tttgtgatgacaacttctcgtgcgtctggtcaggaaattcgtccacttaaggttctgatc
cttaacctgatgccgaagaagattgaaactgaaaatcagtttctgcgcctgctttcaaac
tcacctttgcaggtcgatattcagctgttgcgcatcgattcccgtgaatcgcgcaacacg
cccgcagagcatctgaacaacttctactgtaactttgaagatattcaggatcagaacttt
gacggtttgattgtaactggtgcgccgctgggcctggtggagtttaatgatgtcgcttac
tggccgcagatcaaacaggtgctggagtggtcgaaagatcacgtcacctcgacgctgttt
gtctgctgggcggtacaggccgcgctcaatatcctctacggcattcctaagcaaactcgc
accgaaaaactctctggcgtttacgagcatcatattctccatcctcatgcgcttctgacg
cgtggctttgatgattcattcctggcaccgcattcgcgctatgctgactttccggcagcg
ttgattcgtgattacaccgatctggaaattctggcagagacggaagaaggggatgcatat
ctgtttgccagtaaagataagcgcattgcctttgtgacgggccatcccgaatatgatgcg
caaacgctggcgcaggaatttttccgcgatgtggaagccggactagacccggatgtaccg
tataactatttcccgcacaatgatccgcaaaatacaccgcgagcgagctggcgtagtcac
ggtaatttactgtttaccaactggctcaactattacgtctaccagatcacgccatacgat
ctacggcacatgaatccaacgctggattaa
              
                            

Download fasta file
RegulonDB