RegulonDB RegulonDB 10.10: Gene Sequence
metB gene sequence


Size: 1161        A: 264  T: 259  G: 351  C: 287

Fasta

 

>metB E. coli K12. Version NC_000913.3 GI:556503834
atgacgcgtaaacaggccaccatcgcagtgcgtagcgggttaaatgacgacgaacagtat
ggttgcgttgtcccaccgatccatctttccagcacctataactttaccggatttaatgaa
ccgcgcgcgcatgattactcgcgtcgcggcaacccaacgcgcgatgtggttcagcgtgcg
ctggcagaactggaaggtggtgctggtgcagtacttactaataccggcatgtccgcgatt
cacctggtaacgaccgtctttttgaaacctggcgatctgctggttgcgccgcacgactgc
tacggcggtagctatcgcctgttcgacagtctggcgaaacgcggttgctatcgcgtgttg
tttgttgatcaaggcgatgaacaggcattacgggcagcgctggcagaaaaacccaaactg
gtactggtagaaagcccaagtaatccattgttacgcgtcgtggatattgcgaaaatctgc
catctggcaagggaagtcggggcggtgagcgtggtggataacaccttcttaagcccggca
ttacaaaatccgctggcattaggtgccgatctggtgttgcattcatgcacgaaatatctg
aacggtcactcagacgtagtggccggcgtggtgattgctaaagacccggacgttgtcact
gaactggcctggtgggcaaacaatattggcgtgacgggcggcgcgtttgacagctatctg
ctgctacgtgggttgcgaacgctggtgccgcgtatggagctggcgcagcgcaacgcgcag
gcgattgtgaaatacctgcaaacccagccgttggtgaaaaaactgtatcacccgtcgttg
ccggaaaatcaggggcatgaaattgccgcgcgccagcaaaaaggctttggcgcaatgttg
agttttgaactggatggcgatgagcagacgctgcgtcgtttcctgggcgggctgtcgttg
tttacgctggcggaatcattagggggagtggaaagtttaatctctcacgccgcaaccatg
acacatgcaggcatggcaccagaagcgcgtgctgccgccgggatctccgagacgctgctg
cgtatctccaccggtattgaagatggcgaagatttaattgccgacctggaaaatggcttc
cgggctgcaaacaaggggtaa
              
                            

Download fasta file
RegulonDB