RegulonDB RegulonDB 10.10: Gene Sequence
metC gene sequence


Size: 1188        A: 291  T: 291  G: 319  C: 287

Fasta

 

>metC E. coli K12. Version NC_000913.3 GI:556503834
atggcggacaaaaagcttgatactcaactggtgaatgcaggacgcagcaaaaaatacact
ctcggcgcggtaaatagcgtgattcagcgcgcttcttcgctggtctttgacagtgtagaa
gccaaaaaacacgcgacacgtaatcgcgccaatggagagttgttctatggacggcgcgga
acgttaacccatttctccttacaacaagcgatgtgtgaactggaaggtggcgcaggctgc
gtgctatttccctgcggggcggcagcggttgctaattccattcttgcttttatcgaacag
ggcgatcatgtgttgatgaccaacaccgcctatgaaccgagtcaggatttctgtagcaaa
atcctcagcaaactgggcgtaacgacatcatggtttgatccgctgattggtgccgatatc
gttaagcatctgcagccaaacactaaaatcgtgtttctggaatcgccaggctccatcacc
atggaagtccacgacgttccggcgattgttgccgccgtacgcagtgtggtgccggatgcc
atcattatgatcgacaacacctgggcagccggtgtgctgtttaaggcgctggattttggc
atcgatgtttctattcaagccgccaccaaatatctggttgggcattcagatgcgatgatt
ggcactgccgtgtgcaatgcccgttgctgggagcagctacgggaaaatgcctatctgatg
ggccagatggtcgatgccgataccgcctatataaccagccgtggcctgcgcacattaggt
gtgcgtttgcgtcaacatcatgaaagcagtctgaaagtggctgaatggctggcagaacat
ccgcaagttgcgcgagttaaccaccctgctctgcctggcagtaaaggtcacgaattctgg
aaacgagactttacaggcagcagcgggctattttcctttgtgcttaagaaaaaactcaat
aatgaagagctggcgaactatctggataacttcagtttattcagcatggcctactcgtgg
ggcgggtatgaatcgttgatcctggcaaatcaaccagaacatatcgccgccattcgccca
caaggcgagatcgattttagcgggaccttgattcgcctgcatattggtctggaagatgtc
gacgatctgattgccgatctggacgccggttttgcgcgaattgtataa
              
                            

Download fasta file
RegulonDB