RegulonDB RegulonDB 10.10: Gene Sequence
metE gene sequence


Size: 2262        A: 521  T: 469  G: 680  C: 592

Fasta

 

>metE E. coli K12. Version NC_000913.3 GI:556503834
atgacaatattgaatcacaccctcggtttccctcgcgttggcctgcgtcgcgagctgaaa
aaagcgcaagaaagttattgggcggggaactccacgcgtgaagaactgctggcggtaggg
cgtgaattgcgtgctcgtcactgggatcaacaaaagcaagcgggtatcgacctgctgccg
gtgggcgattttgcctggtacgatcatgtactgaccaccagtctgctgctgggtaacgtt
ccggcgcgtcatcagaacaaagatggttcggtagatatcgacaccctgttccgtattggt
cgtggacgtgcgccgactggcgaacctgcggcggcagcggaaatgaccaaatggtttaac
accaactatcactacatggtgccggagttcgttaaaggccaacagttcaaactgacctgg
acgcagctgctggacgaagtggacgaggcgctggcgctgggccacaaggtgaaacctgtg
ctgctggggccggttacctggctgtggctggggaaagtgaaaggtgaacaatttgaccgc
ctgagcctgctgaacgacattctgccggtttatcagcaagtgctggcagaactggcgaaa
cgcggcatcgagtgggtacagattgatgaacccgcgctggtactggaactaccacaggcg
tggctggacgcatacaaacccgcttacgacgcgctccagggacaggtgaaactgctgctg
accacctattttgaaggcgtaacgccaaatctcgacacgattactgcgctgcctgttcag
ggtctgcatgttgacctcgtacatggtaaagatgacgttgctgaactgcacaagcgcctg
ccttctgactggttgctgtctgcgggtctgatcaatggtcgtaacgtctggcgcgccgat
cttaccgagaaatatgcgcaaattaaggacattgtcggcaaacgtgatttgtgggtggca
tcttcctgctcgttgctgcacagccccatcgacctgagcgtggaaacgcgtcttgatgca
gaagtgaaaagctggtttgccttcgccctacaaaaatgccatgaactggcactgctgcgc
gatgcgctgaacagtggtgacacggcagctctggcagagtggagcgccccgattcaggca
cgtcgtcactctacccgcgtacataatccggcggtagaaaagcgtctggcggcgatcacc
gcccaggacagccagcgtgcgaatgtctatgaagtgcgtgctgaagcccagcgtgcgcgt
tttaaactgccagcgtggccgaccaccacgattggttccttcccgcaaaccacggaaatt
cgtaccctgcgtctggatttcaaaaagggcaatctcgacgccaacaactaccgcacgggc
attgcggaacatatcaagcaggccattgttgagcaggaacgtttgggactggatgtgctg
gtacatggcgaggccgagcgtaatgacatggtggaatactttggcgagcacctcgacgga
tttgtctttacgcaaaacggttgggtacagagctacggttcccgctgcgtgaagccaccg
attgtcattggtgacattagccgcccggcaccgattaccgtggagtgggcgaagtatgcg
caatcgctgaccgacaaaccggtgaaagggatgctgacggggccggtgaccatactctgc
tggtcgttcccgcgtgaagatgtcagccgtgaaaccatcgccaaacagattgcgctggcg
ctgcgtgatgaagtggccgatctggaagccgctggaattggcatcatccagattgacgaa
ccggcgctgcgcgaaggtttaccgctgcgtcgtagcgactgggatgcgtatctccagtgg
ggcgtagaggccttccgtatcaacgccgccgtggcgaaagatgacacacaaatccacact
cacatgtgttattgcgagttcaacgacatcatggattcgattgcggcgctggacgcagac
gtcatcaccatcgaaacctcgcgttccgacatggagttgctggagtcgtttgaagagttt
gattatccaaatgaaatcggtcctggcgtctatgacattcactcgccaaacgtaccgagc
gtggaatggattgaagccttgctgaagaaagcggcaaaacgcattccggcagagcgcctg
tgggtcaacccggactgtggcctgaaaacgcgcggctggccagaaacccgcgcggcactg
gcgaacatggtgcaggcggcgcagaacttgcgtcgggggtaa
              
                            

Download fasta file
RegulonDB