RegulonDB RegulonDB 10.9: Gene Sequence
metH gene sequence


Size: 3684        A: 882  T: 745  G: 1079  C: 978

Fasta

 

>metH E. coli K12. Version NC_000913.3 GI:556503834
gtgagcagcaaagtggaacaactgcgtgcgcagttaaatgaacgtattctggtgctggac
ggcggtatgggcaccatgatccagagttatcgactgaacgaagccgattttcgtggtgaa
cgctttgccgactggccatgcgacctcaaaggcaacaacgacctgctggtactcagtaaa
ccggaagtgatcgccgctatccacaacgcctactttgaagcgggcgcggatatcatcgaa
accaacaccttcaactccacgaccattgcgatggcggattaccagatggaatccctgtcg
gcggaaatcaactttgcggcggcgaaactggcgcgagcttgtgctgacgagtggaccgcg
cgcacgccagagaaaccgcgctacgttgccggtgttctcggcccgaccaaccgcacggcg
tctatttctccggacgtcaacgatccggcatttcgtaatatcacttttgacgggctggtg
gcggcttatcgagagtccaccaaagcgctggtggaaggtggcgcggatctgatcctgatt
gaaaccgttttcgacacccttaacgccaaagcggcggtatttgcggtgaaaacggagttt
gaagcgctgggcgttgagctgccgattatgatctccggcaccatcaccgacgcctccggg
cgcacgctctccgggcagaccaccgaagcattttacaactcattgcgccacgccgaagct
ctgacctttggcctgaactgtgcgctggggcccgatgaactgcgccagtacgtgcaggag
ctgtcacggattgcggaatgctacgtcaccgcgcacccgaacgccgggctacccaacgcc
tttggtgagtacgatctcgacgccgacacgatggcaaaacagatacgtgaatgggcgcaa
gcgggttttctcaatatcgtcggcggctgctgtggcaccacgccacaacatattgcagcg
atgagtcgtgcagtagaaggattagcgccgcgcaaactgccggaaattcccgtagcctgc
cgtttgtccggcctggagccgctgaacattggcgaagatagcctgtttgtgaacgtgggt
gaacgcaccaacgtcaccggttccgctaagttcaagcgcctgatcaaagaagagaaatac
agcgaggcgctggatgtcgcgcgtcaacaggtggaaaacggcgcgcagattatcgatatc
aacatggatgaagggatgctcgatgccgaagcggcgatggtgcgttttctcaatctgatt
gccggtgaaccggatatcgctcgcgtgccgattatgatcgactcctcaaaatgggacgtc
attgaaaaaggtctgaagtgtatccagggcaaaggcattgttaactctatctcgatgaaa
gagggcgtcgatgcctttatccatcacgcgaaattgttgcgtcgctacggtgcggcagtg
gtggtaatggcctttgacgaacagggacaggccgatactcgcgcacggaaaatcgagatt
tgccgtcgggcgtacaaaatcctcaccgaagaggttggcttcccgccagaagatatcatc
ttcgacccaaacatcttcgcggtcgcaactggcattgaagagcacaacaactacgcgcag
gactttatcggcgcgtgtgaagacatcaaacgcgaactgccgcacgcgctgatttccggc
ggcgtatctaacgtttctttctcgttccgtggcaacgatccggtgcgcgaagccattcac
gcagtgttcctctactacgctattcgcaatggcatggatatggggatcgtcaacgccggg
caactggcgatttacgacgacctacccgctgaactgcgcgacgcggtggaagatgtgatt
cttaatcgtcgcgacgatggcaccgagcgtttactggagcttgccgagaaatatcgcggc
agcaaaaccgacgacaccgccaacgcccagcaggcggagtggcgctcgtgggaagtgaat
aaacgtctggaatactcgctggtcaaaggcattaccgagtttatcgagcaggataccgaa
gaagcccgccagcaggctacgcgcccgattgaagtgattgaaggcccgttgatggacggc
atgaatgtggtcggcgacctgtttggcgaagggaaaatgttcctgccacaggtggtcaaa
tcggcgcgcgtcatgaaacaggcggtggcctacctcgaaccgtttattgaagccagcaaa
gagcagggcaaaaccaacggcaagatggtgatcgccaccgtgaagggcgacgtccacgac
atcggtaaaaatatcgttggtgtggtgctgcaatgtaacaactacgaaattgtcgatctc
ggcgttatggtgcctgcggaaaaaattctccgtaccgctaaagaagtgaatgctgatctg
attggcctttcggggcttatcacgccgtcgctggacgagatggttaacgtggcgaaagag
atggagcgtcagggcttcactattccgttactgattggcggcgcgacgacctcaaaagcg
cacacggcggtgaaaatcgagcagaactacagcggcccgacggtgtatgtgcagaatgcc
tcgcgtaccgttggtgtggtggcggcgctgctttccgatacccagcgtgatgattttgtc
gctcgtacccgcaaggagtacgaaaccgtacgtattcagcacgggcgcaagaaaccgcgc
acaccaccggtcacgctggaagcggcgcgcgataacgatttcgcttttgactggcaggct
tacacgccgccggtggcgcaccgtctcggcgtgcaggaagtcgaagccagcatcgaaacg
ctgcgtaattacatcgactggacaccgttctttatgacctggtcgctggccgggaagtat
ccgcgcattctggaagatgaagtggtgggcgttgaggcgcagcggctgtttaaagacgcc
aacgacatgctggataaattaagcgccgagaaaacgctgaatccgcgtggcgtggtgggc
ctgttcccggcaaaccgtgtgggcgatgacattgaaatctaccgtgacgaaacgcgtacc
catgtgatcaacgtcagccaccatctgcgtcaacagaccgaaaaaacaggcttcgctaac
tactgtctcgctgacttcgttgcgccgaagctttctggtaaagcagattacatcggcgca
tttgccgtgactggcgggctggaagaggacgcactggctgatgcctttgaagcgcagcac
gatgattacaacaaaatcatggtgaaagcgcttgccgaccgtttagccgaagcctttgcg
gagtatctccatgagcgtgtgcgtaaagtctactggggctatgcgccgaacgagaacctc
agcaacgaagagctgatccgcgaaaactaccagggcatccgtccggcaccgggctatccg
gcctgcccggaacatacggaaaaagccaccatctgggagctgctggaagtggaaaaacac
actggcatgaaactcacagaatctttcgccatgtggcccggtgcatcggtttcgggttgg
tacttcagccacccggacagcaagtactacgctgtagcacaaattcagcgcgatcaggtt
gaagattatgcccgccgtaaaggtatgagcgttaccgaagttgagcgctggctggcaccg
aatctggggtatgacgcggactga
              
                            

Download fasta file
RegulonDB