RegulonDB RegulonDB 10.10: Gene Sequence
metJ gene sequence


Size: 318        A: 92  T: 61  G: 88  C: 77

Fasta

 

>metJ E. coli K12. Version NC_000913.3 GI:556503834
atggctgaatggagcggcgaatatatcagcccatacgctgagcacggcaagaagagtgaa
caagtcaaaaagattacggtttccattcctcttaaggtgttaaaaatcctcaccgatgaa
cgcacgcgtcgtcaggtgaacaacctgcgtcacgctaccaacagcgagctgctgtgcgaa
gcgtttctgcatgcctttaccgggcaacctttgccggatgatgccgatctgcgtaaagag
cgcagcgacgaaatcccggaagcggcaaaagagatcatgcgtgagatggggattaacccg
gagacgtgggaatactaa
              
                            

Download fasta file
RegulonDB