RegulonDB RegulonDB 10.9: Gene Sequence
mglA gene sequence


Size: 1521        A: 434  T: 397  G: 371  C: 319

Fasta

 

>mglA E. coli K12. Version NC_000913.3 GI:556503834
atggtcagctcaacgactccgtcctccggggaatacttgttggaaatgagcggtatcaac
aagtcctttcctggtgttaaggcacttgataacgttaatttaaaagtccggccacattct
atccatgcattaatgggggaaaacggtgcaggaaaatcgacattattaaaatgcctgttt
ggtatttatcaaaaagactccggcaccattttattccagggtaaagagatcgatttccat
tctgcaaaagaagccctggaaaatggtatttcgatggtacaccaggagttaaacctggta
ttacaacgttcggtgatggataacatgtggctggggcgatatcccaccaaaggcatgttt
gtcgatcaggacaaaatgtaccgcgaaaccaaagcgatttttgacgaactggatattgat
atcgatccgcgtgcgcgcgtcggcacattatccgtttcgcaaatgcagatgatcgaaatc
gccaaagcgttttcctataacgcgaaaattgtgattatggatgaaccgacttcttcgtta
accgaaaaagaggtcaatcatctgttcactattattcgtaaattaaaagagcgcggctgc
ggtattgtttatatctcgcataaaatggaagaaatcttccagttatgtgatgaagttacc
gtattgcgcgacggtcagtggatcgccaccgaaccgctggcaggactgacgatggacaag
atcatcgccatgatggttgggcgttctcttaaccagcgtttccctgacaaagaaaacaaa
ccgggcgaagtcatcctcgaggtacgtaacctgacgtcactgcgccagccgtcgattcgc
gatgtctcgtttgatctgcataaaggggagatcctcggtattgccggtctggtgggggcg
aaacgtaccgatattgttgagacgttatttggtattcgcgagaaatcggctggcaccata
acgttgcacggcaaacagatcaataaccataatgccaacgaagccataaaccatggattt
gcactggtaactgaggagcgccgctcaacgggaatttatgcctatctggatattggtttt
aactcgttaatttccaatattcgcaactacaaaaataaagttggtttactggataactcg
cggatgaaaagcgatacccagtgggtgattgattcgatgcgggtaaaaacgccgggtcat
cggacgcaaattggttcgctctccggtggtaatcagcaaaaggtgattattggtcgctgg
ctactaacgcaaccagaaatattaatgctcgatgaaccgacgcgcggtattgatgtcggg
gcgaagtttgaaatttatcagttaattgccgaactggcgaagaaaggcaaggggattatt
attatctcctctgaaatgcctgagttgttagggataacagaccgtattctggtcatgagc
aatggtctcgtttccggaattgtcgatacaaaaacaacaacgcaaaacgaaattctgcgt
cttgcgtctttgcacctttaa
              
                            

Download fasta file
RegulonDB