RegulonDB RegulonDB 10.9: Gene Sequence
mglC gene sequence


Size: 1011        A: 201  T: 302  G: 280  C: 228

Fasta

 

>mglC E. coli K12. Version NC_000913.3 GI:556503834
atgagtgcgttaaataagaaaagttttcttacttacctgaaagagggcggtatttacgtc
gttcttttagttttgctggcgattattattttccaggacccaacatttttaagtctgttg
aacttaagtaatattctcacccagtcatcggtgcgtattattatcgcgctcggtgtggca
gggttaattgtcacccaggggaccgatctttctgctggtcgtcaggtagggctggcggca
gtggtggctgcgacattattgcagtccatggataacgccaacaaagtgttcccggaaatg
gcgacgatgccgattgcgctggttattctgattgtctgtgccattggtgcggtgatcggt
ttgatcaacggtctgattatcgcttatctcaacgtgacgccgttcattaccacgctcggc
acgatgatcatcgtctatggcatcaactcgctctattacgactttgtcggggcgtcgcca
atttctggttttgacagtggcttctctacctttgctcagggctttgtcgcgctggggagt
ttccgtctctcttacatcaccttctacgcgttgattgcggtggcgttcgtctgggtgttg
tggaacaaaacccgcttcggtaagaacatttttgccattggcggtaacccggaagcggca
aaagtatctggtgtcaacgtcggcctgaacctgctgatgatctacgcgttgtctggcgtg
ttctatgcctttggcgggatgttagaagccggacgtatcggctctgccaccaacaacctc
ggctttatgtatgagctggatgctatcgcggcgtgcgtggtaggcggtgtatcgttcagc
ggcggtgtggggacggtgattggcgtggtgaccggggtaattatttttaccgtcatcaac
tatggcctgacgtatatcggcgtaaacccatactggcagtacatcatcaaaggggcgatt
attatcttcgccgtagcgctggattcactgaaatacgcgcgtaagaaatga
              
                            

Download fasta file
RegulonDB