RegulonDB RegulonDB 10.9: Gene Sequence
mraY gene sequence


Size: 1083        A: 190  T: 315  G: 318  C: 260

Fasta

 

>mraY E. coli K12. Version NC_000913.3 GI:556503834
atgttagtttggctggccgaacatttggtcaaatattattccggctttaacgtcttttcc
tatctgacgtttcgcgccatcgtcagcctgctgaccgcgctgttcatctcattgtggatg
ggcccgcgtatgattgctcatttgcaaaaactttcctttggtcaggtggtgcgtaacgac
ggtcctgaatcacacttcagcaagcgcggtacgccgaccatgggcgggattatgatcctg
acggcgattgtgatctccgtactgctgtgggcttacccgtccaatccgtacgtctggtgc
gtgttggtggtgctggtaggttacggtgttattggctttgttgatgattatcgcaaagtg
gtgcgtaaagacaccaaagggttgatcgctcgttggaagtatttctggatgtcggtcatt
gcgctgggtgtcgccttcgccctgtaccttgccggcaaagacacgcccgcaacgcagctg
gtggtcccattctttaaagatgtgatgccgcagctggggctgttctacattctgctggct
tacttcgtcattgtgggtactggcaacgcggtaaacctgaccgatggtctcgacggcctg
gcaattatgccgaccgtatttgtcgccggtggttttgcgctggtggcgtgggcgaccggc
aatatgaactttgccagctacttgcatataccgtatctgcgacacgccggggaactggtt
attgtctgtaccgcgatagtcggggcaggactgggcttcctgtggtttaacacctatccg
gcgcaggtctttatgggcgatgtaggttcgctggcgttaggtggtgcgttaggcattatc
gccgtactgctacgtcaggaattcctgctggtgattatggggggcgtgttcgtggtagaa
acgctttctgtcatcctgcaggtcggctcctttaaactgcgcggacaacgtattttccgc
atggcaccgattcatcaccactatgaactgaaaggctggccggaaccgcgcgtcattgtg
cgtttctggattatttcgctgatgctggttctgattggtctggcaacgctgaaggtacgt
taa
              
                            

Download fasta file
RegulonDB