RegulonDB RegulonDB 10.9: Gene Sequence
mrcB gene sequence


Size: 2535        A: 592  T: 545  G: 762  C: 636

Fasta

 

>mrcB E. coli K12. Version NC_000913.3 GI:556503834
atggccgggaatgaccgcgagccaattggacgcaaagggaaaccgacgcgtccggtcaaa
caaaaggtaagccgtcgtcgttacgaagatgacgatgattacgacgattatgatgactat
gaggatgaagaaccgatgccgcgcaaaggtaagggcaaaggcaaagggcgtaagcctcgt
ggcaaacgcggctggctatggctactgctaaaactggctatcgtttttgccgtgctgatc
gccatttacggcgtttatctcgatcaaaaaattcgtagccgtattgatggcaaggtctgg
caactgcctgcggcagtttatggccgaatggtcaatcttgagccagacatgaccatcagc
aagaacgagatggtgaagctgctggaggcgacccagtatcgtcaggtgtcgaaaatgacc
cgtcctggcgaatttaccgtgcaggccaacagcattgagatgattcgccgtccgtttgat
ttcccggacagtaaagaaggacaggtgcgcgcgcgtctgacctttgatggcgatcatctg
gcgacgatcgtcaatatggagaacaaccgtcagttcggtttcttccgtcttgatccgcgt
ctgatcaccatgatctcttcgccaaacggtgagcagcgtctgtttgtgccgcgcagtggt
ttcccggatttgctggtggatactttgctggcgacagaagaccgtcatttttacgagcat
gatggaatcagtctctactcaatcggacgtgcggtgctggcaaacctgaccgccggacgc
acggtacagggtgcgagtacgctgacgcaacagctggtgaaaaacctgttcctctccagc
gagcgttcttactggcgtaaagcgaacgaagcttacatggcgctgatcatggacgcgcgt
tacagcaaagaccgtattcttgagctgtatatgaacgaggtgtatctcggtcagagcggc
gacaacgaaatccgcggcttcccgctggcaagcttgtattactttggtcgcccggtagaa
gagctaagcctcgaccagcaggcgctgttagtcggtatggtgaaaggggcgtccatctac
aacccgtggcgtaacccaaaactggcgctggagcgacgtaatctggtgctgcgtctgctg
caacagcaacagattattgatcaagaactctatgacatgttgagtgcccgtccgctgggg
gttcagccgcgcggtggggtgatctctcctcagccagcctttatgcaactggtgcgtcag
gagctgcaggcaaaactgggcgataaggtaaaagatctctccggcgtgaagatcttcact
acctttgactcggtggcccaggacgcggcagaaaaagccgccgtggaaggcattccggca
ctgaagaaacagcgtaagttgagcgatcttgaaactgcgattgtggtcgtcgaccgcttt
agtggtgaagttcgtgcgatggtcggaggttctgagccgcagtttgcgggctacaaccgt
gcgatgcaggcgcgtcgttcgattggttcccttgcaaaaccagcgacttatctgacggcc
ttaagccagccgaaaatctatcgtctgaatacgtggattgcggatgcgccaattgcgctg
cgtcagccgaatggccaggtctggtcaccgcagaatgatgaccgtcgttatagcgaaagc
ggcagagtgatgctggtggatgcgttgacccgttcgatgaacgtgccgacggtaaatctg
gggatggcgctggggctgcctgcggttacggagacctggattaaactgggcgtaccgaaa
gatcagttgcatccggttccggcaatgctgctgggggcgttgaacttaacgccaatcgaa
gtggcgcaggcattccagaccatcgccagcggtggtaaccgtgcaccgctttctgcgctg
cgttcggtaatcgcggaagatggcaaagtgctgtatcagagcttcccgcaggcggaacgc
gctgttccggcgcaggcggcgtatctgacactatggaccatgcagcaggtggtacaacgc
ggtacgggtcgtcagcttggggcgaaatacccgaacctgcatctggcagggaaaacaggg
actaccaacaataacgtagatacctggtttgcgggcattgacggcagcacggtgaccatc
acctgggtcggccgtgataacaaccagccgaccaaactgtatggtgccagcggggcaatg
tcgatttatcagcgttatctggctaaccagacgccaacgccgctgaatcttgttccgcca
gaagatattgcagatatgggcgtggactacgacggcaactttgtttgcagcggtggcatg
cgtatcttgccggtctggaccagcgatccgcaatcgctgtgccagcagagcgagatgcag
cagcagccgtcaggcaatccgtttgatcagtcttctcagccgcagcaacagccgcaacag
caacctgctcagcaagagcagaaagacagcgacggtgtagccggttggatcaaggatatg
tttggtagtaattaa
              
                            

Download fasta file
RegulonDB