RegulonDB RegulonDB 10.9: Gene Sequence
mrdA gene sequence


Size: 1902        A: 469  T: 434  G: 507  C: 492

Fasta

 

>mrdA E. coli K12. Version NC_000913.3 GI:556503834
atgaaactacagaactcttttcgcgactatacggcagagtccgcgctgtttgtgcgccgg
gcgctggtcgcctttttggggattttgctgctgaccggcgtgcttatcgccaacctgtat
aatctgcaaattgttcgctttaccgactaccagacccgctctaatgaaaaccgcattaag
ctggtgcctatcgcgcccagccgcggcattatctacgatcgtaacggtatccctctggcc
ctcaaccgcactatctaccagatagaaatgatgccggagaaagtcgataacgtgcagcaa
acgctggacgctttgcgcagcgtggtagatctgaccgatgacgatattgctgcattccga
aaagagcgcgcacgttcacaccgtttcacctctattccggtgaaaactaacctgaccgaa
gtacaagtagctcgctttgccgtcaatcagtaccgttttccgggtgtcgaagttaaaggc
tataaacgtcgttactatccttacggttcggcgttgacccacgtcatcggctatgtgtcg
aaaatcaacgataaagacgtcgaacgcctgaataatgacggcaaactggccaactatgcg
gcaacgcatgatatcggtaagctgggcattgagcgttactatgaagatgtgctgcacggt
cagaccggttatgaagaggttgaagttaacaaccgtgggcgtgttattcgccagttaaaa
gaagtaccaccgcaagccggacacgatatttacctgacgctggatctcaaactccagcaa
tatattgaaacgctgctggcgggtagccgcgcagctgtggtagtcaccgatccgcgtaca
ggtggggtgctggcgctggtttccacgcctagttatgacccaaacttgtttgttgacggt
atctccagcaaagattattccgccttgttgaacgatccgaatacaccgctggtgaaccgc
gccacacagggggtttatcctcccgcgtctacagttaaaccctatgtggcggtttcggca
ttgagcgccggggtgatcacgcgcaatacgacgctgtttgacccaggctggtggcaactg
ccaggttcggaaaaacgttatcgtgactggaaaaaatggggccacgggcgtctgaatgtc
acaagatcgctggaagaatctgcggataccttcttctatcaggtggcctacgatatgggg
atcgatcgcctctccgaatggatgggtaaattcggttatggtcattacaccggtatcgac
ctggcggaagaacgttccggcaacatgcctacccgcgaatggaaacagaaacgctttaaa
aaaccgtggtatcagggtgacaccattccggttggtatcggtcagggttactggacagcg
accccaatccagatgagtaaggcactgatgatcctgattaatgacggtatcgtgaaggtt
cctcatttgctgatgagcaccgccgaagacggcaaacaggtgccatgggtacagccgcat
gaaccgcccgtcggcgatattcattccggttactgggagctggcgaaagacggtatgtac
ggtgttgctaaccgccctaacggtacggcgcataaatactttgctagcgcaccgtacaaa
attgcggcgaaatccggtaccgctcaggtcttcggtctgaaagcgaacgaaacctataat
gcgcacaaaattgccgagcgtttacgtgaccacaaactgatgaccgcctttgcgccatac
aacaatccgcaagtggctgtcgccatgattctggagaacggtggtgcgggtccggcggtt
ggtacactgatgcgccagatcctcgaccacattatgctgggtgataacaacaccgatctg
cctgcggaaaatccagcggttgccgcagcggaggaccattaa
              
                            

Download fasta file
RegulonDB