RegulonDB RegulonDB 10.9: Gene Sequence
mrp gene sequence


Size: 1110        A: 277  T: 234  G: 313  C: 286

Fasta

 

>mrp E. coli K12. Version NC_000913.3 GI:556503834
atgaacgaacaatcccaggccaaatcaccagaagccttgcgcgcaatggtcgccgggaca
ctggccaattttcagcacccaaccctgaagcataacctcaccacgctgaaagcgttgcac
catgtcgcctggatggacgacacgttgcatgtggaactggttatgccgtttgtctggcat
agcgcgttcgaagagttaaaagagcaatgtagcgccgaactgctgcgcatcaccggggcg
aaagctatcgactggaaactgtcgcataacatagccactctgaaacgcgtgaagaatcag
ccgggaattaacggtgtgaagaacattatcgcggtgagttccggtaaaggcggcgtgggt
aaatcgtccacggcggtaaacctggcactggcgctggcggcagaaggggcgaaagtcggc
attctggacgccgatatctacggcccatcaatcccaacaatgttgggcgcagaaaatcag
cgtccaacttcgccggacggtacccatatggcaccgattatgtctcatggcctggcaacc
aattcaattggttatctggtcactgacgacaatgcgatggtgtggcgtggaccgatggcg
agcaaggcgttaatgcagatgttgcaggaaaccttgtggccggatctcgactatctggtg
cttgatatgccgccaggcaccggtgacattcaattgacgctggcgcaaaacattccagta
accggtgcagtcgtggtcaccaccccgcaggacatcgcgctgatcgatgcgaaaaaaggc
attgtgatgttcgagaaagtcgaggttccggtgctcggtattgtcgagaacatgagtgtg
catatttgcagtaactgtggtcaccatgaaccgattttcggtaccggtggtgcagagaaa
ctggctgaaaaataccatacacagctgctggggcagatgccgttacacatctccttacgt
gaggatctcgataaaggtacgccaacggttatcagccgtccggagagcgaatttaccgct
atctaccgccagctggctgaccgcgttgcagctcagctctactggcagggtgaagtcatt
ccaggcgagatttccttccgcgcggtctaa
              
                            

Download fasta file
RegulonDB