RegulonDB RegulonDB 10.9: Gene Sequence
lpxM gene sequence


Size: 972        A: 240  T: 231  G: 277  C: 224

Fasta

 

>lpxM E. coli K12. Version NC_000913.3 GI:556503834
atggaaacgaaaaaaaataatagcgaatacattcctgagtttgataaatcctttcgccac
ccgcgctactggggagcatggctgggcgtagcagcgatggcgggtatcgctttaacgccg
ccaaagttccgtgatcccattctggcacggctgggacgttttgccggacgactgggaaaa
agctcacgccgtcgtgcgttaatcaatctgtcgctctgctttccagaacgtagtgaagct
gaacgcgaagcgattgttgatgagatgtttgccaccgcgccgcaagcgatggcaatgatg
gctgagttggcaatacgcgggccggagaaaattcagccgcgcgttgactggcaagggctg
gagatcatcgaagagatgcggcgtaataacgagaaagttatctttctggtgccgcacggt
tgggccgtcgatattcctgccatgctgatggcctcgcaagggcagaaaatggcagcgatg
ttccataatcagggcaacccggtttttgattatgtctggaacacggtgcgtcgtcgcttt
ggcggtcgtctgcatgcgagaaatgacggtattaaaccattcatccagtcggtacgtcag
gggtactggggatattatttacccgatcaggatcatggcccagagcacagcgaatttgtg
gatttctttgccacctataaagcgacgttgcccgcgattggtcgtttgatgaaagtgtgc
cgtgcgcgcgttgtaccgctgtttccgatttatgatggcaagacgcatcgtctgacgatt
caggtgcgcccaccgatggatgatctgttagaggcggatgatcatacgattgcgcggcgg
atgaatgaagaagtcgagatttttgttggtccgcgaccagaacaatacacctggatacta
aaattgctgaaaactcgcaaaccgggcgaaatccagccgtataagcgcaaagatctttat
cccatcaaataa
              
                            

Download fasta file
RegulonDB