RegulonDB RegulonDB 10.9: Gene Sequence
mukB gene sequence


Size: 4461        A: 1055  T: 923  G: 1321  C: 1162

Fasta

 

>mukB E. coli K12. Version NC_000913.3 GI:556503834
atgattgaacgcggtaaatttcgctcactgacgctgattaactggaacggcttttttgcc
cgaacttttgaccttgacgagctggtcacgacgctttctggcggtaacggggcgggtaaa
tccaccaccatggcggcgttcgttacggcgctgatccccgacctgaccctgctgcatttc
cgtaacactacggaagccggggccaccagcggttcgcgcgataaaggtctgcacggtaag
ctgaaagcgggtgtctgttattcgatgctcgacaccattaactcgcgccaccagcgcgtg
gtggtcggtgtgcgtctgcaacaggttgccggacgcgatcgtaaagtggatatcaagccg
tttgccattcagggactgccgatgtcggtgcagccgacacagctggtgaccgaaaccctg
aacgaacgccaggcgcgcgtgctgccgcttaacgagctgaaagacaagctcgaggcgatg
gaaggcgtgcagtttaaacagttcaactccattactgattaccactcgctgatgttcgat
ctgggcatcatcgcgcgtcgtctgcgctccgcatctgaccgtagcaaattctatcgtctg
atcgaagcttcgctgtatggcgggatctccagtgccattacccgttctctgcgcgactac
ctgttgccagaaaacagcggcgtgcgtaaagcgttccaggacatggaagcggcgctgcgt
gaaaaccgtatgacgctggaagcgattcgtgtcacccagtcggaccgcgacctgtttaag
catctgatcagcgaagccaccaactacgtggcggcggactacatgcgtcacgccaacgag
cgccgtgtccatctcgacaaagccctggagtttcgtcgcgagctacatacttcgcgtcag
caactggcggctgagcagtacaaacacgtcgatatggcgcgtgagctggcagagcacaac
ggtgccgaaggcgatctggaagcggattatcaggcggccagtgatcacctgaacctggtg
caaaccgcactgcgtcagcaggagaagatcgaacgctacgaagcggatctcgatgagctg
cagatccgtctggaagagcaaaatgaagtggtggcagaagccatcgaacgccagcaagag
aatgaggctcgtgcggaagctgccgaactggaagtggacgagctgaaaagccagcttgct
gactaccagcaggcgctggacgtccagcaaacgcgcgcgatccagtataaccaggcgatt
gctgcgcttaatcgtgccaaagaactgtgccatctgccggacttaaccgccgactgcgcc
gccgaatggctggaaaccttccaggcgaaagagctggaagcgactgaaaaaatgctctct
cttgagcagaaaatgagcatggcgcaaaccgcgcacagccagtttgagcaggcttatcag
ctggtggtggcaatcaacggcccactggcgcgtaacgaggcgtgggatgtcgctcgcgaa
ctattgcgcgaaggggtcgatcagcgtcacctggcagagcaggttcagccgctgcggatg
cgattaagcgaactggaacagcgtctacgcgagcagcaagaagctgagcgtctgctggca
gatttctgcaaacgtcagggcaagaattttgatatcgacgaactggaagccctgcatcag
gaactggaagcacgcattgcctctctttccgatagcgtgtctaacgcccgtgaagagcgc
atggcactgcgccaggagcaggaacagctgcagtctcgcattcagagtttgatgcagcgt
gcgccggtttggctggcagcgcaaaacagtctcaaccagttgagcgaacagtgcggcgaa
gagtttacctccagccaggacgtcaccgaatatctgcaacagttgctggagcgtgagcga
gaggcgattgttgaacgcgatgaagtgggcgcgcgcaaaaacgccgtcgatgaagagatc
gaacgtttaagccagcctggcggctctgaagatcagcgtctgaacgcgctggcggagcgt
tttggtggtgtgctgctgtcagaaatttatgacgacgttagcctggaagatgcgccgtac
ttctcagcgctgtatggcccgtcacgccacgccatcgtggtgccagatctgtcacaggta
actgaacacctggaaggcttgaccgattgcccggaagatctctatctgatcgaaggagat
ccgcagtcattcgatgacagcgtgttcagcgttgatgagctggaaaaagcggtagtggtg
aaaatcgccgatcgtcagtggcgttattcacgtttcccggaagtgccgctgtttggtcgt
gctgcgcgtgaaagccgtattgaaagcctccatgccgagcgtgaagtgctttccgaacgc
ttcgccacgctctcctttgatgtacagaaaactcagcgtctgcatcaggcgttcagccgc
tttatcggcagtcatctggcggttgcgtttgagtctgacccggaagcagaaatccgtcaa
ctgaacagccgtcgcgtcgaactggagcgggcgttaagtaatcatgaaaatgataaccag
cagcagcgtattcagtttgagcaggcgaaagagggcgttacggcgctgaaccgcattctg
ccgcgtctcaacctgttggctgatgacagcctggcggatcgcgtcgatgaaatccgcgaa
cgtctggatgaagcccaggaagccgcgcgttttgttcagcagtttggcaatcaactggcg
aaactggaaccgattgtttcggtattgcagagcgacccggaacagttcgaacagttaaaa
gaagattacgcgtactctcagcagatgcagcgcgatgcccgtcagcaggcgtttgccctg
acggaagtggtgcagcgtcgtgcgcactttagctattctgactcggcagaaatgcttagc
ggtaacagcgatctcaacgaaaaactgcgtgaacgtctggaacaggcggaagcggagcgt
acccgcgctcgcgaagcgttgcgcggtcacgcagcgcagttgagtcagtacaaccaggtg
ctggcttcgctgaaaagttcttacgacaccaaaaaagagctactcaacgatctgcaacgt
gaattgcaggatatcggcgtgcgtgctgatagcggggcagaagagcgggcgcgtattcgc
cgtgacgagctgcatgcgcaactgagcaataaccgttcacgccgcaatcaactggaaaaa
gcgcttaccttctgcgaagcggagatggacaacctgacccgcaaactgcgcaagctggag
cgggattactttgagatgcgcgagcaggtagtgaccgccaaagcgggctggtgtgcggtg
atgcgcatggtgaaagataacggcgttgagcgccgcttacaccgtcgtgagctggcttat
ctctccgctgatgatttgcgttccatgtcggataaggcgttaggtgcgctgcgtctggcg
gtggcggataacgaacatctgcgcgacgtgctgcgcatgtcggaagatccgaaacgtccg
gagcgtaaaattcagttcttcgtggcggtttatcagcatctgcgtgaacgtattcgtcag
gatattattcgtaccgatgatccggtggaagctatcgaacagatggagattgaacttagc
cgtctgaccgaagaattaacctcccgtgaacagaaactggcgatcagttcccgcagcgtg
gcgaacatcattcgcaaaaccattcagcgcgagcagaaccgtatccgtatgctcaaccag
gggttgcagaacgtatcgtttggtcaggtgaacagcgtgcgtctcaacgtgaacgtgcgt
gaaacgcacgccatgctactggatgtgctctctgaacagcacgagcagcatcaggatctg
tttaacagcaaccgtttgaccttctcggaagcgctggcgaaactgtatcaacgtcttaac
ccgcagattgatatggggcagcgcacgccgcagaccatcggtgaagaactgctggattac
cgcaactatctggaaatggaagttgaggttaaccgtggttccgatggctggctgcgcgca
gagtctggtgcattgtcgaccggtgaggcgattggtaccggtatgtcgattctggtgatg
gtggtacaaagctgggaagatgaatctcgccgcctgcgcggtaaagatatctctccttgc
cgcctgctgttcctcgatgaagcagcgcgactggatgctcgttctatcgccacgctgttt
gaattgtgtgagcgtttgcaaatgcaactcatcatcgcagcgccggaaaatatcagcccg
gagaaaggcaccacctataaactggtgcgtaaagtcttccagaataccgaacacgttcat
gtcgtcggcctgcgaggatttgcgccgcaactccctgaaacgcttccaggaactgacgaa
gcgccttctcaggcgagttaa
              
                            

Download fasta file
RegulonDB